ID: 1007356075

View in Genome Browser
Species Human (GRCh38)
Location 6:41318818-41318840
Sequence GATGCCACAAATTCACTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007356075_1007356088 27 Left 1007356075 6:41318818-41318840 CCCCCCAGTGAATTTGTGGCATC No data
Right 1007356088 6:41318868-41318890 TGCACGTGCCGCTGTCCTGGAGG No data
1007356075_1007356087 24 Left 1007356075 6:41318818-41318840 CCCCCCAGTGAATTTGTGGCATC No data
Right 1007356087 6:41318865-41318887 CACTGCACGTGCCGCTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007356075 Original CRISPR GATGCCACAAATTCACTGGG GGG (reversed) Intergenic