ID: 1007356076

View in Genome Browser
Species Human (GRCh38)
Location 6:41318819-41318841
Sequence TGATGCCACAAATTCACTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007356076_1007356088 26 Left 1007356076 6:41318819-41318841 CCCCCAGTGAATTTGTGGCATCA No data
Right 1007356088 6:41318868-41318890 TGCACGTGCCGCTGTCCTGGAGG No data
1007356076_1007356087 23 Left 1007356076 6:41318819-41318841 CCCCCAGTGAATTTGTGGCATCA No data
Right 1007356087 6:41318865-41318887 CACTGCACGTGCCGCTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007356076 Original CRISPR TGATGCCACAAATTCACTGG GGG (reversed) Intergenic