ID: 1007356077

View in Genome Browser
Species Human (GRCh38)
Location 6:41318820-41318842
Sequence CTGATGCCACAAATTCACTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007356077_1007356088 25 Left 1007356077 6:41318820-41318842 CCCCAGTGAATTTGTGGCATCAG No data
Right 1007356088 6:41318868-41318890 TGCACGTGCCGCTGTCCTGGAGG No data
1007356077_1007356089 30 Left 1007356077 6:41318820-41318842 CCCCAGTGAATTTGTGGCATCAG No data
Right 1007356089 6:41318873-41318895 GTGCCGCTGTCCTGGAGGACAGG No data
1007356077_1007356087 22 Left 1007356077 6:41318820-41318842 CCCCAGTGAATTTGTGGCATCAG No data
Right 1007356087 6:41318865-41318887 CACTGCACGTGCCGCTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007356077 Original CRISPR CTGATGCCACAAATTCACTG GGG (reversed) Intergenic