ID: 1007356080

View in Genome Browser
Species Human (GRCh38)
Location 6:41318822-41318844
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007356080_1007356087 20 Left 1007356080 6:41318822-41318844 CCAGTGAATTTGTGGCATCAGGA No data
Right 1007356087 6:41318865-41318887 CACTGCACGTGCCGCTGTCCTGG No data
1007356080_1007356089 28 Left 1007356080 6:41318822-41318844 CCAGTGAATTTGTGGCATCAGGA No data
Right 1007356089 6:41318873-41318895 GTGCCGCTGTCCTGGAGGACAGG No data
1007356080_1007356088 23 Left 1007356080 6:41318822-41318844 CCAGTGAATTTGTGGCATCAGGA No data
Right 1007356088 6:41318868-41318890 TGCACGTGCCGCTGTCCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007356080 Original CRISPR TCCTGATGCCACAAATTCAC TGG (reversed) Intergenic