ID: 1007356081

View in Genome Browser
Species Human (GRCh38)
Location 6:41318846-41318868
Sequence AGTGGAAGGAGTGCTGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 602
Summary {0: 1, 1: 0, 2: 5, 3: 69, 4: 527}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007356081_1007356093 18 Left 1007356081 6:41318846-41318868 CCCAGCCCAGCACTCCTTCCACT 0: 1
1: 0
2: 5
3: 69
4: 527
Right 1007356093 6:41318887-41318909 GAGGACAGGAAGCAGAGCCAGGG No data
1007356081_1007356092 17 Left 1007356081 6:41318846-41318868 CCCAGCCCAGCACTCCTTCCACT 0: 1
1: 0
2: 5
3: 69
4: 527
Right 1007356092 6:41318886-41318908 GGAGGACAGGAAGCAGAGCCAGG No data
1007356081_1007356088 -1 Left 1007356081 6:41318846-41318868 CCCAGCCCAGCACTCCTTCCACT 0: 1
1: 0
2: 5
3: 69
4: 527
Right 1007356088 6:41318868-41318890 TGCACGTGCCGCTGTCCTGGAGG No data
1007356081_1007356089 4 Left 1007356081 6:41318846-41318868 CCCAGCCCAGCACTCCTTCCACT 0: 1
1: 0
2: 5
3: 69
4: 527
Right 1007356089 6:41318873-41318895 GTGCCGCTGTCCTGGAGGACAGG No data
1007356081_1007356087 -4 Left 1007356081 6:41318846-41318868 CCCAGCCCAGCACTCCTTCCACT 0: 1
1: 0
2: 5
3: 69
4: 527
Right 1007356087 6:41318865-41318887 CACTGCACGTGCCGCTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007356081 Original CRISPR AGTGGAAGGAGTGCTGGGCT GGG (reversed) Intergenic