ID: 1007356082

View in Genome Browser
Species Human (GRCh38)
Location 6:41318847-41318869
Sequence CAGTGGAAGGAGTGCTGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007356082_1007356088 -2 Left 1007356082 6:41318847-41318869 CCAGCCCAGCACTCCTTCCACTG No data
Right 1007356088 6:41318868-41318890 TGCACGTGCCGCTGTCCTGGAGG No data
1007356082_1007356092 16 Left 1007356082 6:41318847-41318869 CCAGCCCAGCACTCCTTCCACTG No data
Right 1007356092 6:41318886-41318908 GGAGGACAGGAAGCAGAGCCAGG No data
1007356082_1007356089 3 Left 1007356082 6:41318847-41318869 CCAGCCCAGCACTCCTTCCACTG No data
Right 1007356089 6:41318873-41318895 GTGCCGCTGTCCTGGAGGACAGG No data
1007356082_1007356087 -5 Left 1007356082 6:41318847-41318869 CCAGCCCAGCACTCCTTCCACTG No data
Right 1007356087 6:41318865-41318887 CACTGCACGTGCCGCTGTCCTGG No data
1007356082_1007356093 17 Left 1007356082 6:41318847-41318869 CCAGCCCAGCACTCCTTCCACTG No data
Right 1007356093 6:41318887-41318909 GAGGACAGGAAGCAGAGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007356082 Original CRISPR CAGTGGAAGGAGTGCTGGGC TGG (reversed) Intergenic