ID: 1007356084

View in Genome Browser
Species Human (GRCh38)
Location 6:41318852-41318874
Sequence ACGTGCAGTGGAAGGAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007356084_1007356089 -2 Left 1007356084 6:41318852-41318874 CCAGCACTCCTTCCACTGCACGT No data
Right 1007356089 6:41318873-41318895 GTGCCGCTGTCCTGGAGGACAGG No data
1007356084_1007356094 26 Left 1007356084 6:41318852-41318874 CCAGCACTCCTTCCACTGCACGT No data
Right 1007356094 6:41318901-41318923 GAGCCAGGGTGCTGCGTACGTGG No data
1007356084_1007356087 -10 Left 1007356084 6:41318852-41318874 CCAGCACTCCTTCCACTGCACGT No data
Right 1007356087 6:41318865-41318887 CACTGCACGTGCCGCTGTCCTGG No data
1007356084_1007356093 12 Left 1007356084 6:41318852-41318874 CCAGCACTCCTTCCACTGCACGT No data
Right 1007356093 6:41318887-41318909 GAGGACAGGAAGCAGAGCCAGGG No data
1007356084_1007356088 -7 Left 1007356084 6:41318852-41318874 CCAGCACTCCTTCCACTGCACGT No data
Right 1007356088 6:41318868-41318890 TGCACGTGCCGCTGTCCTGGAGG No data
1007356084_1007356092 11 Left 1007356084 6:41318852-41318874 CCAGCACTCCTTCCACTGCACGT No data
Right 1007356092 6:41318886-41318908 GGAGGACAGGAAGCAGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007356084 Original CRISPR ACGTGCAGTGGAAGGAGTGC TGG (reversed) Intergenic