ID: 1007356085

View in Genome Browser
Species Human (GRCh38)
Location 6:41318860-41318882
Sequence ACAGCGGCACGTGCAGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007356085_1007356089 -10 Left 1007356085 6:41318860-41318882 CCTTCCACTGCACGTGCCGCTGT No data
Right 1007356089 6:41318873-41318895 GTGCCGCTGTCCTGGAGGACAGG No data
1007356085_1007356097 30 Left 1007356085 6:41318860-41318882 CCTTCCACTGCACGTGCCGCTGT No data
Right 1007356097 6:41318913-41318935 TGCGTACGTGGCTCTTCAGAGGG No data
1007356085_1007356094 18 Left 1007356085 6:41318860-41318882 CCTTCCACTGCACGTGCCGCTGT No data
Right 1007356094 6:41318901-41318923 GAGCCAGGGTGCTGCGTACGTGG No data
1007356085_1007356092 3 Left 1007356085 6:41318860-41318882 CCTTCCACTGCACGTGCCGCTGT No data
Right 1007356092 6:41318886-41318908 GGAGGACAGGAAGCAGAGCCAGG No data
1007356085_1007356096 29 Left 1007356085 6:41318860-41318882 CCTTCCACTGCACGTGCCGCTGT No data
Right 1007356096 6:41318912-41318934 CTGCGTACGTGGCTCTTCAGAGG No data
1007356085_1007356093 4 Left 1007356085 6:41318860-41318882 CCTTCCACTGCACGTGCCGCTGT No data
Right 1007356093 6:41318887-41318909 GAGGACAGGAAGCAGAGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007356085 Original CRISPR ACAGCGGCACGTGCAGTGGA AGG (reversed) Intergenic