ID: 1007356087

View in Genome Browser
Species Human (GRCh38)
Location 6:41318865-41318887
Sequence CACTGCACGTGCCGCTGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007356080_1007356087 20 Left 1007356080 6:41318822-41318844 CCAGTGAATTTGTGGCATCAGGA No data
Right 1007356087 6:41318865-41318887 CACTGCACGTGCCGCTGTCCTGG No data
1007356075_1007356087 24 Left 1007356075 6:41318818-41318840 CCCCCCAGTGAATTTGTGGCATC No data
Right 1007356087 6:41318865-41318887 CACTGCACGTGCCGCTGTCCTGG No data
1007356077_1007356087 22 Left 1007356077 6:41318820-41318842 CCCCAGTGAATTTGTGGCATCAG No data
Right 1007356087 6:41318865-41318887 CACTGCACGTGCCGCTGTCCTGG No data
1007356078_1007356087 21 Left 1007356078 6:41318821-41318843 CCCAGTGAATTTGTGGCATCAGG No data
Right 1007356087 6:41318865-41318887 CACTGCACGTGCCGCTGTCCTGG No data
1007356076_1007356087 23 Left 1007356076 6:41318819-41318841 CCCCCAGTGAATTTGTGGCATCA No data
Right 1007356087 6:41318865-41318887 CACTGCACGTGCCGCTGTCCTGG No data
1007356081_1007356087 -4 Left 1007356081 6:41318846-41318868 CCCAGCCCAGCACTCCTTCCACT 0: 1
1: 0
2: 5
3: 69
4: 527
Right 1007356087 6:41318865-41318887 CACTGCACGTGCCGCTGTCCTGG No data
1007356083_1007356087 -9 Left 1007356083 6:41318851-41318873 CCCAGCACTCCTTCCACTGCACG No data
Right 1007356087 6:41318865-41318887 CACTGCACGTGCCGCTGTCCTGG No data
1007356082_1007356087 -5 Left 1007356082 6:41318847-41318869 CCAGCCCAGCACTCCTTCCACTG No data
Right 1007356087 6:41318865-41318887 CACTGCACGTGCCGCTGTCCTGG No data
1007356084_1007356087 -10 Left 1007356084 6:41318852-41318874 CCAGCACTCCTTCCACTGCACGT No data
Right 1007356087 6:41318865-41318887 CACTGCACGTGCCGCTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007356087 Original CRISPR CACTGCACGTGCCGCTGTCC TGG Intergenic