ID: 1007356089

View in Genome Browser
Species Human (GRCh38)
Location 6:41318873-41318895
Sequence GTGCCGCTGTCCTGGAGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007356081_1007356089 4 Left 1007356081 6:41318846-41318868 CCCAGCCCAGCACTCCTTCCACT 0: 1
1: 0
2: 5
3: 69
4: 527
Right 1007356089 6:41318873-41318895 GTGCCGCTGTCCTGGAGGACAGG No data
1007356082_1007356089 3 Left 1007356082 6:41318847-41318869 CCAGCCCAGCACTCCTTCCACTG No data
Right 1007356089 6:41318873-41318895 GTGCCGCTGTCCTGGAGGACAGG No data
1007356080_1007356089 28 Left 1007356080 6:41318822-41318844 CCAGTGAATTTGTGGCATCAGGA No data
Right 1007356089 6:41318873-41318895 GTGCCGCTGTCCTGGAGGACAGG No data
1007356077_1007356089 30 Left 1007356077 6:41318820-41318842 CCCCAGTGAATTTGTGGCATCAG No data
Right 1007356089 6:41318873-41318895 GTGCCGCTGTCCTGGAGGACAGG No data
1007356078_1007356089 29 Left 1007356078 6:41318821-41318843 CCCAGTGAATTTGTGGCATCAGG No data
Right 1007356089 6:41318873-41318895 GTGCCGCTGTCCTGGAGGACAGG No data
1007356084_1007356089 -2 Left 1007356084 6:41318852-41318874 CCAGCACTCCTTCCACTGCACGT No data
Right 1007356089 6:41318873-41318895 GTGCCGCTGTCCTGGAGGACAGG No data
1007356083_1007356089 -1 Left 1007356083 6:41318851-41318873 CCCAGCACTCCTTCCACTGCACG No data
Right 1007356089 6:41318873-41318895 GTGCCGCTGTCCTGGAGGACAGG No data
1007356085_1007356089 -10 Left 1007356085 6:41318860-41318882 CCTTCCACTGCACGTGCCGCTGT No data
Right 1007356089 6:41318873-41318895 GTGCCGCTGTCCTGGAGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007356089 Original CRISPR GTGCCGCTGTCCTGGAGGAC AGG Intergenic