ID: 1007356093

View in Genome Browser
Species Human (GRCh38)
Location 6:41318887-41318909
Sequence GAGGACAGGAAGCAGAGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007356083_1007356093 13 Left 1007356083 6:41318851-41318873 CCCAGCACTCCTTCCACTGCACG No data
Right 1007356093 6:41318887-41318909 GAGGACAGGAAGCAGAGCCAGGG No data
1007356086_1007356093 0 Left 1007356086 6:41318864-41318886 CCACTGCACGTGCCGCTGTCCTG No data
Right 1007356093 6:41318887-41318909 GAGGACAGGAAGCAGAGCCAGGG No data
1007356085_1007356093 4 Left 1007356085 6:41318860-41318882 CCTTCCACTGCACGTGCCGCTGT No data
Right 1007356093 6:41318887-41318909 GAGGACAGGAAGCAGAGCCAGGG No data
1007356084_1007356093 12 Left 1007356084 6:41318852-41318874 CCAGCACTCCTTCCACTGCACGT No data
Right 1007356093 6:41318887-41318909 GAGGACAGGAAGCAGAGCCAGGG No data
1007356081_1007356093 18 Left 1007356081 6:41318846-41318868 CCCAGCCCAGCACTCCTTCCACT 0: 1
1: 0
2: 5
3: 69
4: 527
Right 1007356093 6:41318887-41318909 GAGGACAGGAAGCAGAGCCAGGG No data
1007356082_1007356093 17 Left 1007356082 6:41318847-41318869 CCAGCCCAGCACTCCTTCCACTG No data
Right 1007356093 6:41318887-41318909 GAGGACAGGAAGCAGAGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007356093 Original CRISPR GAGGACAGGAAGCAGAGCCA GGG Intergenic