ID: 1007359552

View in Genome Browser
Species Human (GRCh38)
Location 6:41345334-41345356
Sequence CAGAGAGAGCTGGTGGGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 677
Summary {0: 1, 1: 0, 2: 2, 3: 68, 4: 606}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007359552_1007359557 22 Left 1007359552 6:41345334-41345356 CCCACTCCCACCAGCTCTCTCTG 0: 1
1: 0
2: 2
3: 68
4: 606
Right 1007359557 6:41345379-41345401 ACCCACCTTCAAAACATGTATGG 0: 1
1: 0
2: 0
3: 7
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007359552 Original CRISPR CAGAGAGAGCTGGTGGGAGT GGG (reversed) Intronic
900236758 1:1596690-1596712 CAGAGAGAGATGGAGGGAGATGG + Intergenic
900345830 1:2209854-2209876 CAGACAGAGCTTGTCGGAGGAGG + Intronic
900690620 1:3978264-3978286 CAGAGACACAGGGTGGGAGTGGG - Intergenic
900714911 1:4138053-4138075 CAGAAAGTGCTGGTGGAAGGGGG - Intergenic
900990921 1:6097964-6097986 CAGAGAGCCCTGGTGGGAAGTGG + Intronic
901200376 1:7463664-7463686 GAGAAACAGATGGTGGGAGTAGG + Intronic
901684347 1:10935315-10935337 CAGGGAGGGTTGGTGGGAGGTGG - Intergenic
901709405 1:11101767-11101789 AAGAGAGAGATGATGGCAGTTGG - Intergenic
902796299 1:18802787-18802809 AAGTGAGTGCTGGTGGCAGTGGG - Intergenic
904045065 1:27603776-27603798 CAGAGAGAGCGGGAGGGAGGAGG - Intronic
904303794 1:29573882-29573904 CAGAGATATGTGGAGGGAGTTGG + Intergenic
904361270 1:29973709-29973731 GGCAGAGAACTGGTGGGAGTTGG + Intergenic
904773937 1:32895455-32895477 CAGAGATGGCTGGCTGGAGTTGG + Intronic
904878056 1:33671652-33671674 CAGAGGGGGCTGGTGGGAAGAGG - Intronic
905119813 1:35672958-35672980 CAGAGAGAGCCTGTGGCTGTCGG - Intergenic
905242508 1:36589946-36589968 CTGAGGGGGCTGGTGGGAGAGGG + Intergenic
905318998 1:37102402-37102424 CATAGAGAGCTCCTGGGATTTGG - Intergenic
905945463 1:41897973-41897995 GAGAGAGAGGTGCTGGGAGAAGG + Intronic
906641474 1:47443436-47443458 CAGAGAGTGCTGCTGAGAGCGGG + Intergenic
907158766 1:52356587-52356609 CAGAGAAACGTGGTGGGACTTGG - Intronic
907385405 1:54122434-54122456 CAGAAAGAGATGCTGGGAGGGGG - Intergenic
908677378 1:66620550-66620572 CAGAGAGAGAGAGTGGGAGGAGG + Intronic
908766144 1:67556236-67556258 CAGAGAGAGCTCCTGGCAGAAGG - Intergenic
908802903 1:67898338-67898360 CAGGGAGATCTGGTGGCAGTGGG + Intergenic
908814070 1:68013701-68013723 GAGAGAGACCTAGTGGGAGGTGG + Intergenic
909268379 1:73591662-73591684 CTAAAAGAGCTTGTGGGAGTGGG + Intergenic
909527452 1:76642655-76642677 GAGAGAGAGATGGCGGGAGAGGG - Intergenic
910015491 1:82518664-82518686 CAGAAAGAGCTTGAGAGAGTGGG + Intergenic
910107626 1:83648416-83648438 GAGAGAGGGCTGGTGGGATTTGG + Intergenic
910425948 1:87120190-87120212 CTGTGAGAGGAGGTGGGAGTGGG - Intronic
910783248 1:90965738-90965760 AAGAGAGAGTTAGTGGGAGATGG - Intronic
913186094 1:116372539-116372561 GAAAGAGAGGTGGTGGGAGGAGG + Intergenic
913368286 1:118067475-118067497 CAGAGAGAGTAAGAGGGAGTGGG - Intronic
913448305 1:118973308-118973330 CAGAGAAAGCTGGTTGGTATGGG - Intronic
913969765 1:143405781-143405803 AAGAGAGAGTCGGTGGGTGTGGG - Intergenic
914064138 1:144231374-144231396 AAGAGAGAGTCGGTGGGTGTGGG - Intergenic
914115012 1:144734980-144735002 AAGAGAGAGTCGGTGGGTGTGGG + Intergenic
914361136 1:146937540-146937562 CAGAGAGAGCAGGATGGAATTGG + Intergenic
914491452 1:148153092-148153114 CAGAGAGAGCAGGATGGAATTGG - Intergenic
915061963 1:153193611-153193633 CCGAAAGAGATGGTGGGATTGGG + Intergenic
915493977 1:156267918-156267940 TAGGGAGAGCTGCTGGGAGGAGG + Intronic
915708986 1:157875318-157875340 CAAAGAGGCCTGGTGGGAGATGG + Intronic
915780686 1:158546841-158546863 CAGAGAGAGTGGGTGGTAGGAGG - Intergenic
916271308 1:162945184-162945206 CAGGGAGAGCTGCTAGAAGTGGG - Intergenic
916457615 1:164986932-164986954 AAGAGAGGGATGGAGGGAGTGGG + Intergenic
917212633 1:172645819-172645841 CATGGAGAAGTGGTGGGAGTGGG + Intergenic
917282877 1:173396040-173396062 CAAAGAGAGGTGGTGAGGGTGGG - Intergenic
917924694 1:179779427-179779449 TAATGAGAGCTGGTGGGATTTGG + Intronic
918002584 1:180511811-180511833 TAGAGAGTGTTGCTGGGAGTCGG - Intergenic
918003995 1:180524820-180524842 CAGAGTGAGCAAGTGGGAGAGGG + Intergenic
918045580 1:180939100-180939122 CAGGCAGAGCTGGGGGGAGAAGG + Intronic
918067181 1:181109265-181109287 CAGAGAGAGCTGTGGGGAGGGGG + Intergenic
918364825 1:183796566-183796588 CAGAGAGAAGTGGTGGGACTAGG + Intronic
919165562 1:193887443-193887465 GGGAGAGACCTGGTGGGAATTGG + Intergenic
919822454 1:201481841-201481863 CAGAGAGAGGAGGAGGGCGTGGG + Intergenic
920198611 1:204245520-204245542 CAGTGTGAGCTGGCAGGAGTGGG + Intronic
920263202 1:204703571-204703593 CAGAGAAAGCACTTGGGAGTAGG - Intergenic
920747746 1:208644808-208644830 AAGAGAGAGCTGCTGGGGGAGGG - Intergenic
920900831 1:210108933-210108955 CAGAGTGTGATGGTGGAAGTGGG + Intronic
921065068 1:211616847-211616869 CAGCCAGAGCTGGAGGGACTTGG + Intergenic
921706110 1:218324041-218324063 TCCACAGAGCTGGTGGGAGTTGG - Intronic
922240919 1:223755194-223755216 CAGTGGGAGATGGTGGGAGATGG - Intronic
923598377 1:235378959-235378981 CAGAGAGAGCCTGTGAGACTAGG - Intronic
1063112331 10:3047870-3047892 CAGAGAGAGAGGGGGAGAGTGGG - Intergenic
1063149431 10:3322989-3323011 CAGAGAGTGGTGCTGGGAGGGGG + Intergenic
1063386070 10:5616965-5616987 CAGAAAGGGCTGGAAGGAGTTGG - Intergenic
1063570836 10:7213348-7213370 CAGAGACAGCAGGTAGGAGGCGG + Intronic
1064219396 10:13427648-13427670 CAGAAAGAGGGGGTGGGAGGGGG + Intergenic
1067079115 10:43203633-43203655 CTGGGAGAGCTGCTGGGAGGCGG - Intronic
1067929848 10:50549538-50549560 CAGAGAGGGATGGTGGGGGAGGG + Intronic
1068580315 10:58731722-58731744 GAGAGAGAGAGGGAGGGAGTGGG + Intronic
1069860011 10:71464655-71464677 GGGAGGGGGCTGGTGGGAGTGGG + Intronic
1070487374 10:76943642-76943664 TAGAGTCAGCTGGTGGGAGATGG - Intronic
1070692110 10:78534554-78534576 CAGAGAGAGTTCTCGGGAGTGGG - Intergenic
1070784195 10:79153708-79153730 CAGAGAGAGGTGCAGGGACTTGG + Intronic
1072716480 10:97755914-97755936 CAGAAAGAGTTGGTAGGTGTTGG + Intronic
1072891503 10:99329325-99329347 GAGCGAGAGCTGGAGGGAGGAGG - Exonic
1073214094 10:101827125-101827147 GGGTGAGAGCTGGTGGGAGTTGG + Intronic
1074205862 10:111282193-111282215 GAGTTAGGGCTGGTGGGAGTAGG + Intergenic
1074396213 10:113100000-113100022 AAGAGAGAGGTAGAGGGAGTGGG - Intronic
1074496553 10:113984564-113984586 CATAGACAGCTGGTGGGGGTGGG + Intergenic
1074895159 10:117770957-117770979 CAGAGGGAGCAGCTGGGAGGTGG + Intergenic
1075519054 10:123133265-123133287 TCGAGAAAGCTGGTGGGAGTCGG - Intergenic
1075803076 10:125164812-125164834 CAGCGAGAGTTACTGGGAGTTGG + Intergenic
1075803683 10:125169952-125169974 CAGAGAGATTTGGTGGGGATGGG - Intergenic
1076059700 10:127404179-127404201 GAGAGGGAGATGGTGGGAGAGGG - Intronic
1076064589 10:127439409-127439431 CAGAGAGACCTGGAGGAAGGTGG + Intronic
1076177300 10:128377907-128377929 CAGGCAGCGGTGGTGGGAGTGGG - Intergenic
1076265163 10:129103964-129103986 CAGATAGGGCTGGTGGGGCTGGG - Intergenic
1076522110 10:131087812-131087834 CAGAGAGAGGTGGCCGGGGTGGG + Intergenic
1076550158 10:131273030-131273052 CAGACAGAGCAGCAGGGAGTTGG + Intronic
1077284525 11:1759779-1759801 CAGGCTGAGCAGGTGGGAGTGGG - Intronic
1077550043 11:3196171-3196193 GAGAGAGAGCAGGTGGGTGTGGG + Intergenic
1078840658 11:15073540-15073562 CAGAGATAGCTGGAGGGGGGGGG - Exonic
1079032920 11:16998965-16998987 GATAGAGGGCTGGTTGGAGTTGG - Intronic
1079130760 11:17745629-17745651 CAGAGGGAGATGCTGGGTGTGGG - Intronic
1079897795 11:26144691-26144713 TAGAGAGTGATGGTGGGAGGAGG - Intergenic
1080018562 11:27533963-27533985 TAGAGAGTGCTGGATGGAGTGGG + Intergenic
1080449097 11:32364039-32364061 CAGAGACAGATGCTGGGACTAGG + Intergenic
1081354084 11:42091882-42091904 CAGTGAGAGCTGGTGGGGAGCGG - Intergenic
1081456226 11:43225631-43225653 CTGAGAGAGCAGGTGAGACTCGG - Intergenic
1081491519 11:43573066-43573088 CCCAGAGGGCTTGTGGGAGTAGG - Intronic
1082802161 11:57423116-57423138 CAGAGAAAGCAAGTGGGAGGTGG - Intronic
1082930750 11:58602442-58602464 GAGAGAGAGATGGGGGGAGAGGG + Intronic
1083864780 11:65447779-65447801 TAAAAAGAGCTTGTGGGAGTGGG - Intergenic
1083990820 11:66244666-66244688 CAGAGAGAGGAGATGGGGGTGGG + Exonic
1084381906 11:68817953-68817975 CAGAGGCAGCCGGTGGGAGGTGG + Intronic
1084421196 11:69061529-69061551 CAGAGAGAGGAGGTGGGGGCAGG + Intronic
1084734664 11:71096867-71096889 CAGAGAGAGCTGGTGGCAAGTGG + Intronic
1084870992 11:72098422-72098444 AAGAGAGAGGGGGTGGGGGTAGG + Intronic
1084960793 11:72715301-72715323 CAGAGACAGCTGGTGGGGCCAGG - Intronic
1085158824 11:74322251-74322273 CAGGTAGAGCTGATGGGAGGAGG + Intergenic
1085745605 11:79111815-79111837 CAGAGAAAGGAGGTGGGAGGGGG + Intronic
1086252304 11:84830955-84830977 GAGACAGAGCTGGGGGGGGTGGG - Intronic
1086855304 11:91858862-91858884 CTGAGAGAGGTGGTGGGAGCAGG - Intergenic
1088001091 11:104881314-104881336 AAAAGACAGCTGGTGGCAGTGGG + Intergenic
1089627574 11:119761432-119761454 CAGACAGAGGTGGTGGGAGGGGG - Intergenic
1089854964 11:121535512-121535534 CAGAGAGAGAGGCTGGGAGGAGG + Intronic
1090854132 11:130597497-130597519 CAGAGAGAGAAGGTGGGAGCAGG - Intergenic
1090875276 11:130783513-130783535 CAGAGGCAGCTGGTGAGAGGCGG + Intergenic
1090966281 11:131600146-131600168 CAGAGAGGGCTGCTGGGAGGAGG - Intronic
1091341815 11:134821855-134821877 CTGGGAGAGCTGGTAGGAGCAGG - Intergenic
1091673150 12:2467353-2467375 CAGAGTGACCTGGTGGCAGGTGG + Intronic
1091685273 12:2557006-2557028 AAGACAGAGCTGGTGGCAGAAGG - Intronic
1091797793 12:3307110-3307132 CAGCCAGAGGTGGTGGGAGGCGG + Intergenic
1091973026 12:4804125-4804147 CAGAGTGAGATGGTGAGAGGAGG + Intronic
1092090980 12:5803538-5803560 CACAGAGAGCCAGTGGGAGCCGG + Intronic
1092204331 12:6606510-6606532 CGGAAAGAGCGGGTGGGTGTGGG - Intronic
1092219748 12:6704941-6704963 AAGGGTGTGCTGGTGGGAGTGGG - Intergenic
1092238140 12:6822298-6822320 CAGAGGGAGGTGGAGGGACTTGG - Intronic
1096258082 12:50074844-50074866 CACACAGAGCTGGTGGGGGTGGG - Intronic
1096480296 12:51935829-51935851 CAGAAAAAGCGGGTGAGAGTGGG - Intergenic
1096530737 12:52241362-52241384 AAGAGAGAACAGCTGGGAGTGGG - Intronic
1097085575 12:56465644-56465666 CAGTGGGGGCTGGTAGGAGTAGG + Intronic
1097853227 12:64434703-64434725 CAGAGAGAGAAACTGGGAGTTGG + Intronic
1098365194 12:69695405-69695427 GATAGAGAGCTGTTGGGAGCTGG + Intronic
1098571128 12:71988498-71988520 GAGAGAGAGTTGGAGGGTGTGGG + Intronic
1098914631 12:76244401-76244423 CAGAGAAAGTATGTGGGAGTAGG + Intergenic
1099594581 12:84644035-84644057 CAGGGAAAGATGGTGAGAGTAGG + Intergenic
1099820939 12:87709166-87709188 GGGAGAGAACTGGTGGGAGGTGG - Intergenic
1099860232 12:88217400-88217422 CAGAGAGTGGAGGTGGGAGGAGG - Intergenic
1100098092 12:91068348-91068370 GAGAGAGAGGTGGTGGGAAGAGG + Intergenic
1100281194 12:93119977-93119999 CAGAGAGAACTGAGGGGAGATGG - Intergenic
1101249534 12:102918143-102918165 ATGAGTGAGCTGGTGGGATTTGG + Intronic
1101686935 12:107033831-107033853 CATAGAGAAGCGGTGGGAGTAGG - Intronic
1101865639 12:108517717-108517739 CACAGAGAACTGGTGGAGGTGGG - Intronic
1102544602 12:113645645-113645667 CAGAGAGGGCTGGGTAGAGTGGG - Intergenic
1102868285 12:116391819-116391841 CAAAGCGAGCTGGAGTGAGTTGG - Intergenic
1103131635 12:118474122-118474144 CAGAAAGACCTGGTAGGAGGAGG - Intergenic
1103394782 12:120599204-120599226 CAGAGAGAGGCGGTGGGTGAGGG + Intergenic
1103603908 12:122072534-122072556 CAGAGAGATTTAGTGGCAGTGGG + Intergenic
1104237270 12:126951027-126951049 CAGAGAGAGAGGGTGGGATGTGG + Intergenic
1104419198 12:128621195-128621217 CAGAGAGAACTGGAGGGAATGGG + Intronic
1105937934 13:25119102-25119124 CTGAGCGAGCTCGTGGGCGTCGG - Intergenic
1106433950 13:29707790-29707812 CAGAGAGGGCATGTGAGAGTAGG - Intergenic
1106805635 13:33303663-33303685 CAGAGGGAGATGAAGGGAGTAGG + Intronic
1107383620 13:39883414-39883436 CAGAGAGACGGGGTGGGGGTGGG - Intergenic
1107513504 13:41107588-41107610 CAGGGACAGGTGGTGGGGGTTGG - Intergenic
1108001921 13:45911647-45911669 CAGAGAGAGAGGGTGAGAGAAGG + Intergenic
1108161461 13:47644679-47644701 CAAAAAGGGCTTGTGGGAGTGGG + Intergenic
1108258084 13:48629760-48629782 CAGTGGGGGCTGGTGGGAGGTGG + Intergenic
1109673694 13:65643647-65643669 CAAAGAGAGCTGATGGGAAGAGG - Intergenic
1112243656 13:97707407-97707429 CAAATAGATCTGATGGGAGTAGG + Intergenic
1112496617 13:99910644-99910666 CAGTGAAAGCTGGTGGGGCTGGG + Intergenic
1112813963 13:103251043-103251065 CAGAAACAGCTGGTGGGGGGTGG + Intergenic
1113615343 13:111676473-111676495 CAGAGAGGCCTGGTGGGCTTTGG + Intergenic
1113620810 13:111761386-111761408 CAGAGAGGCCTGGTGGGCTTTGG + Intergenic
1113809247 13:113128058-113128080 CATAGAGAACTGGGGGGAGGGGG + Intronic
1116095426 14:40360493-40360515 CTGAGGGACCTGGTGGGAGGTGG + Intergenic
1116248857 14:42455838-42455860 CAAAGAGGGGTGTTGGGAGTGGG - Intergenic
1117258280 14:54002651-54002673 GGGAGTGAGTTGGTGGGAGTGGG - Intergenic
1117377552 14:55129685-55129707 CAGCGGGACCTGGTGGGACTGGG - Intronic
1117647444 14:57866278-57866300 CAGAGAAGGGTGTTGGGAGTGGG + Intronic
1118315384 14:64722809-64722831 GAGGGAGAGCCAGTGGGAGTGGG + Intronic
1118688280 14:68313473-68313495 CCGACTCAGCTGGTGGGAGTTGG - Intronic
1118743922 14:68760435-68760457 CAGAGAGAGAGGCTGGGAGCTGG + Intergenic
1118780529 14:69004842-69004864 CAGGGAGAGCTGGGGGAAGAGGG - Intergenic
1118973151 14:70654242-70654264 CAGAGAGAGCTGGGGGATGAGGG - Intronic
1119035418 14:71226467-71226489 AAGAAAGGGCTGGTGGGAGTGGG - Intergenic
1119173816 14:72554750-72554772 AAGAGAGAGCTGGTGTGAAAAGG + Intronic
1119188837 14:72664622-72664644 CAGAGGGGGCAGGTGGGAGGTGG - Intronic
1120317883 14:82919561-82919583 CAGAGAGACATGGTGGGAAGTGG - Intergenic
1120509439 14:85395821-85395843 AAGAGAGAACTGGTGGGAGGGGG + Intergenic
1121083205 14:91125538-91125560 CAGAGAGAGCTGGCTCGAGAAGG - Intronic
1121210160 14:92202469-92202491 CAGAGAGAGCTGATGGTGGCTGG + Intergenic
1121282577 14:92709946-92709968 GAGAGAGAGCTGGTTTGAGTGGG + Intronic
1121283269 14:92714721-92714743 CAGACAGACCTGGTGTGAGGTGG + Intronic
1121414545 14:93770153-93770175 CAGGGAGAGATGGTGGTGGTGGG - Intronic
1121475095 14:94192609-94192631 AAGTGAGAGCTGCTAGGAGTAGG + Intronic
1122033794 14:98933110-98933132 CAGAGGTAGCTAGTGGGAATAGG + Intergenic
1122117182 14:99533677-99533699 CCCAGGGAGCTGGTGGGAGCAGG + Intronic
1122306676 14:100770918-100770940 CACTGAGAGCTGGTAGGAGCTGG + Intergenic
1122871621 14:104641376-104641398 CAGGGAGGGGTGGCGGGAGTGGG - Intergenic
1123066604 14:105622323-105622345 CAGGGAGAGGTGGGGAGAGTGGG + Intergenic
1202905974 14_GL000194v1_random:72716-72738 CAGTGAGGGCTGGTGGGGGAAGG + Intergenic
1202928852 14_KI270725v1_random:21233-21255 CAGAAAGAACTGTTCGGAGTTGG - Intergenic
1123984242 15:25630886-25630908 CAGGGAGTGCTGGTGGCAGGTGG + Intergenic
1124214516 15:27795539-27795561 CTGAGAGAGAGGGTGAGAGTGGG - Intronic
1124227043 15:27903443-27903465 CCTAGAGAGTAGGTGGGAGTTGG - Intronic
1125686187 15:41564649-41564671 CAGAGAGAGGGGGAGGGAGAGGG + Intronic
1125722482 15:41851915-41851937 TAAAGAGAGCTGGGGGCAGTGGG - Intronic
1126066073 15:44827423-44827445 CAGAGTGAGCGGGTGGGTGAGGG - Intergenic
1126093762 15:45073141-45073163 CAGAGTGAGCGGGTGGGTGAGGG + Intronic
1126362878 15:47864275-47864297 GGGAGGGAGCTGGTGGGAGGTGG + Intergenic
1126475868 15:49064400-49064422 CACAGAGAACTGGGTGGAGTAGG - Intergenic
1127203875 15:56691582-56691604 GAGAGAGAGCTGTTGAGGGTAGG - Intronic
1127311228 15:57753855-57753877 CAGAGTGAGCTGGGGGGGATGGG + Intronic
1127455455 15:59152419-59152441 AAGAGAGAGTGGGTGGGAGCAGG + Intronic
1128449907 15:67799460-67799482 AAGAGAGAGCAGGTGGTATTTGG + Intronic
1128476780 15:68004295-68004317 CAGAAAGAGATGGTAGGAGATGG + Intergenic
1128496156 15:68199784-68199806 GAGAGAGGGATGGAGGGAGTAGG - Intronic
1128783830 15:70380178-70380200 CAGACAGAGCTGGGGGGACTTGG + Intergenic
1128910585 15:71510491-71510513 GAGAGAAAGATGGTGTGAGTGGG + Intronic
1129637890 15:77341613-77341635 CAGCCTGACCTGGTGGGAGTAGG - Intronic
1129663321 15:77565351-77565373 CAGAGAGGGGTGGTGGGAATGGG + Intergenic
1130226947 15:82066391-82066413 AAGATGGAGCTGGAGGGAGTGGG - Intergenic
1130317418 15:82808756-82808778 CTGAGACAGGTGGTGGGAATGGG - Intergenic
1130450833 15:84050168-84050190 CAGAGAGATAGGGTGGGAATGGG + Intergenic
1130650212 15:85758166-85758188 GGGAGAGAGGGGGTGGGAGTTGG + Intergenic
1130905125 15:88234851-88234873 TAGGGTGCGCTGGTGGGAGTGGG - Intronic
1131272171 15:90954114-90954136 CAGGGAGGGCTGCTGTGAGTGGG + Intergenic
1131389341 15:92034336-92034358 CAGAGAGAGCAGGCTGGGGTGGG + Intronic
1131394114 15:92073110-92073132 CAGAGAGAGCTTGGGAGACTTGG + Intronic
1132020785 15:98360271-98360293 CAGAGAGAGCTGTGTGGAGGGGG - Intergenic
1132460791 16:53607-53629 CAGTGGGAGCTGCCGGGAGTTGG - Exonic
1132745632 16:1435037-1435059 CTGAGGGAGCGGGTGGGAGCTGG + Intronic
1132952264 16:2569915-2569937 CAGGGGGAGGTGGTGGGAGATGG + Intronic
1132962087 16:2630255-2630277 CAGGGGGAGGTGGTGGGAGATGG - Intergenic
1133838698 16:9389030-9389052 CAGAGAGAGCTTGGGGCATTGGG + Intergenic
1134076118 16:11292661-11292683 CAGGCAAACCTGGTGGGAGTGGG + Intronic
1134308331 16:13053577-13053599 CAGAGAGAGGTGGTAGGTGATGG - Intronic
1134637111 16:15800766-15800788 GAGAGAGAACTGATTGGAGTTGG - Intronic
1134784134 16:16925495-16925517 CAAAGAGGGGTGGTGGGAGTGGG + Intergenic
1135187604 16:20328694-20328716 CTGAGAAAGGTGGTGTGAGTGGG - Intergenic
1135195011 16:20386972-20386994 CAGAGAGAGCTTGTGGCAACCGG + Intronic
1135228962 16:20687055-20687077 CTGAGAGAAGAGGTGGGAGTTGG - Intronic
1135522596 16:23188962-23188984 CAGAGTGAGCTGGGTGGAGAAGG + Intronic
1136033289 16:27519101-27519123 CAGAGAGAGGAGGTGGCATTTGG + Intronic
1136228730 16:28875163-28875185 CAAAGTGAGCTGGTGGGGATGGG - Intergenic
1137635050 16:49978527-49978549 CAGGGAGTGCAGGTGGGAGTTGG - Intergenic
1137757698 16:50915620-50915642 CAGAGAGAGTTGCAGGTAGTAGG + Intergenic
1137879852 16:52034734-52034756 CAGAATGAGATGTTGGGAGTAGG + Intronic
1138322228 16:56125447-56125469 CAGAGGAACATGGTGGGAGTGGG - Intergenic
1138691912 16:58776421-58776443 GAGACAGAGGTGGGGGGAGTGGG - Intergenic
1138837873 16:60460040-60460062 CAGAGAGAACTGAGGGTAGTTGG - Intergenic
1138950907 16:61911624-61911646 GAGAGAGAGGTGGTGGGGGGGGG - Intronic
1139377583 16:66509822-66509844 CAGGCAGAGCTGGTGGGGGCAGG - Exonic
1139434076 16:66926150-66926172 CTGAGAGGGCTGTTGGGGGTGGG + Intergenic
1140411717 16:74745113-74745135 CAGAGAGGCCTGGAGGGACTGGG - Intronic
1141174990 16:81712921-81712943 CAGAGGGAGCTGGATGGTGTGGG - Intergenic
1141538539 16:84700198-84700220 CGGAGCGAGCGTGTGGGAGTGGG + Intronic
1141683069 16:85555331-85555353 CAGAGAGAGGGGGTGGAAGGAGG - Intergenic
1141696046 16:85619934-85619956 AAGGGAGAGCGGGTGGGAGTTGG - Intronic
1141729543 16:85812464-85812486 CAGCGGGAGCTCTTGGGAGTAGG + Intergenic
1142157450 16:88539140-88539162 CAGGCAAAGCTGGGGGGAGTGGG - Intergenic
1142263143 16:89051778-89051800 CAGAAAGAGCTGGGGGCCGTGGG - Intergenic
1142484622 17:238737-238759 GAGAGAGAGCTGCTGGGGGTGGG - Intronic
1142608808 17:1096774-1096796 TGGAGAGAGCTGGGGGAAGTGGG + Intronic
1142718660 17:1762293-1762315 CAGAGGGAGCTGGGGGGACAAGG + Intronic
1142738395 17:1916253-1916275 AAGAGAGAGATGCTGGGAGAGGG + Intergenic
1143297612 17:5883227-5883249 CAGAGTGGGGTGGTGGCAGTGGG - Intronic
1143403643 17:6661547-6661569 CAGAGAGAGCTGGCAGTACTGGG - Intergenic
1143868829 17:9943405-9943427 CAGAAAGCGCTGTTGGGAGTGGG - Intronic
1144956844 17:19022978-19023000 CAGAGCGAGGTGTTGGGTGTAGG + Intronic
1145103616 17:20096956-20096978 TAGAGCTAGCGGGTGGGAGTGGG + Intronic
1146473623 17:33144344-33144366 GAGAGAGAGCGGGTGGGATAGGG + Intronic
1146529953 17:33600026-33600048 CAGAGAGAGATGATGGGGCTTGG - Intronic
1148814714 17:50319226-50319248 CAGAGCGGGGTGGTGGGGGTGGG + Intergenic
1148943473 17:51236679-51236701 CAGAGAGAGGTGATGGAGGTAGG - Intronic
1148984940 17:51613218-51613240 CAGAGAGAGATGGACTGAGTAGG - Intergenic
1149003809 17:51783842-51783864 CAGAGAGAGCAGGTGTGAGGGGG + Intronic
1149058746 17:52395756-52395778 CAGGGAAGGCTGGTGAGAGTGGG - Intergenic
1149547885 17:57517867-57517889 CAGAAAGAGATGGTGGGGGATGG + Intronic
1151424914 17:74024727-74024749 CAGAGAAACCTGCTGGGGGTGGG - Intergenic
1151714681 17:75825297-75825319 CAGGGAGAGCTGGGGGCAGCTGG - Exonic
1152120160 17:78413585-78413607 CAGTGTGAGCAGGTGTGAGTGGG - Intronic
1152268993 17:79312854-79312876 GGGAGAGAGCTGGCAGGAGTGGG + Intronic
1152844276 17:82590161-82590183 CAGAGAGAGGAGGTGGCAGATGG + Intronic
1153515451 18:5896375-5896397 CAGAGAGGGGAGGTGGGGGTAGG + Intergenic
1155679980 18:28476519-28476541 TAGTGAGAGGTGGTGGGAGATGG + Intergenic
1155858457 18:30865488-30865510 CAGAGAGAGGTTGTAGGGGTAGG + Intergenic
1156354187 18:36327630-36327652 GAGAGAGAGATGATGGCAGTGGG - Intronic
1156696573 18:39774851-39774873 CAGGCAGAGCTGGGGGGAGGAGG - Intergenic
1157755968 18:50218197-50218219 GAGAAAGAGCTGGAGAGAGTAGG + Intergenic
1157804090 18:50645092-50645114 CAGGGAGAACTGGTGGAAGGCGG + Intronic
1158101644 18:53835783-53835805 AGGAGAGAGAGGGTGGGAGTGGG - Intergenic
1158692011 18:59669351-59669373 ACGAGATGGCTGGTGGGAGTAGG - Intronic
1158932166 18:62333039-62333061 AAAAGAGAGCTGGAGGGAGAAGG + Intronic
1159111003 18:64056585-64056607 GAGAGAGACCTGGTGGGAGGTGG + Intergenic
1159749553 18:72283412-72283434 CAGAGAAAACTGCTGTGAGTTGG + Intergenic
1159958035 18:74533639-74533661 CTGGGAGAGATGGTGGGGGTGGG - Intergenic
1160144510 18:76352502-76352524 CAGAGTGAGCTGGGGTGAGCTGG + Intergenic
1160162110 18:76481166-76481188 CCCAGTGAGCTGGTGGGACTTGG - Intronic
1160319276 18:77875142-77875164 CAGAGAGGGCTGTGGGGAGGTGG - Intergenic
1160451384 18:78968691-78968713 CAGAGAGATCTGGTGCTGGTGGG - Intergenic
1160512579 18:79460903-79460925 CAGGGAGAGCAGGTGTGAGGGGG - Intronic
1161221548 19:3120331-3120353 CAGAGAGCCCTGGTGGGGGGAGG + Intronic
1161527442 19:4765542-4765564 CAGGGAGAGGGTGTGGGAGTTGG - Intergenic
1161773291 19:6242894-6242916 CAGAGAGAGCTGCTGTCAGATGG - Intronic
1162727761 19:12700331-12700353 CAGAGAGAGATGCTCGGGGTAGG + Exonic
1163627856 19:18401132-18401154 CAGTGAGAGGTGGGGGGAGGGGG - Intergenic
1163730779 19:18948095-18948117 CACAGCAAGCTGGTGGGACTTGG - Intergenic
1164493109 19:28732294-28732316 GAGAGGGAACTGGTGGGAGGTGG - Intergenic
1164787201 19:30942984-30943006 AAGGGAAAGCTGGTGGGTGTTGG - Intergenic
1164821775 19:31256329-31256351 GAGAGAGAGCTGATGGGGCTGGG - Intergenic
1165211272 19:34237812-34237834 CAAAGACAGCTGGTGGCTGTTGG + Intergenic
1165305046 19:34998688-34998710 CAGAGGAAGGTGGTGGGAGGAGG + Intronic
1166069014 19:40376993-40377015 CAGAGAGAGGTGTTGGGACCAGG + Intronic
1166069894 19:40380893-40380915 CAGCGAGAGCTGGTAGTAGTGGG + Exonic
1166215268 19:41330836-41330858 GAGAGAGAGGGAGTGGGAGTGGG + Exonic
1166557059 19:43707282-43707304 CAGAGAGAGAGGGTGGGAGGAGG - Intergenic
1166824751 19:45601906-45601928 CAGAGACATCAGGCGGGAGTTGG + Intronic
1166834520 19:45659190-45659212 CAGAGAGAGATGGGGAGAGGGGG - Intergenic
1166980839 19:46631218-46631240 AAGGGAGGGCTGGTGGGAGTGGG - Intergenic
1167104624 19:47423021-47423043 CAGAGAGAGATGGAGAGAGAGGG - Intergenic
1168121362 19:54254149-54254171 CAGAGAGAGATGTTGGGTGTTGG - Intronic
1168382858 19:55939004-55939026 GAGACAGAGCTTGTGGGAGAAGG - Intergenic
1168464914 19:56594732-56594754 AAGAGGGAGCGGGTGGGAGGAGG - Intergenic
1168511031 19:56973727-56973749 CAGAGAGTGCAGGTGGGGATGGG + Intergenic
925310229 2:2876552-2876574 CAGGGAGAGCGGCTGGGAGAAGG - Intergenic
925387629 2:3473170-3473192 CAGAGAGAGCAGGTGAGGGGGGG + Intronic
925644795 2:6024953-6024975 CAAAGAGAGATGGTGACAGTGGG - Intergenic
925693614 2:6550783-6550805 CAAAAAGTGCTGGTGGGAGTGGG + Intergenic
926205851 2:10833935-10833957 CAGAGAGCACTGGTGGGACCTGG - Intronic
926867942 2:17380136-17380158 AAGAGCCTGCTGGTGGGAGTGGG - Intergenic
927011280 2:18907083-18907105 AAGAGAGAGGTTGGGGGAGTGGG - Intergenic
927147739 2:20178063-20178085 CAGTGAGGGCAGGTGTGAGTGGG + Intergenic
927256340 2:21043815-21043837 CAGAGGGAGCGGGAGGGAGCCGG - Intronic
927465114 2:23331028-23331050 CAGAGTGACCTGCTGGGAATGGG + Intergenic
928199978 2:29241589-29241611 CAGAAAGAGGTGGTGGGAATTGG + Intronic
928204159 2:29272157-29272179 GAGAGAGAGAAGGAGGGAGTCGG + Intronic
928432134 2:31228951-31228973 AAGAGACACCTGGTGGGAGAGGG + Intronic
929258848 2:39842578-39842600 GAGAGAGAGAGGGTGGGGGTTGG + Intergenic
929961273 2:46498049-46498071 GAGAGACAGCTGGCGGGCGTGGG + Intronic
930056698 2:47257811-47257833 CTGAGAGAGGTCGTGGGGGTGGG + Intergenic
930700628 2:54456092-54456114 CAGAGGGAGCGGGCGGGAGTGGG + Intergenic
931125372 2:59270280-59270302 CTGAGTGAGGTGGTGGCAGTTGG - Intergenic
931707778 2:64961817-64961839 AAGAGAGAGGTGGTGGGGATGGG - Intergenic
931749907 2:65321177-65321199 CTGAGAGAGCAGGTCAGAGTGGG + Intronic
932110696 2:68996690-68996712 CAGAGAGAGCTAGAGAGAGTTGG - Intergenic
932215655 2:69964368-69964390 CCGTGAGAGCTGGAAGGAGTTGG + Intergenic
932711407 2:74067102-74067124 AAGGGAGAGCAGGGGGGAGTGGG - Intronic
932765996 2:74470492-74470514 CAAAGAGAGTTGGTGGGATTTGG + Intergenic
932820487 2:74895542-74895564 CCCACAGAGCAGGTGGGAGTTGG - Intergenic
934188288 2:89764563-89764585 CAGGGAGGGCTGGTGGGTGATGG + Intergenic
934518038 2:95001165-95001187 CAGAGACAGCTAGTGGCAGGAGG - Intergenic
934920859 2:98344233-98344255 CTGACAGAGCAGGTGAGAGTGGG - Intronic
935036273 2:99377546-99377568 GCAAGGGAGCTGGTGGGAGTAGG - Intronic
935368597 2:102320994-102321016 CAGTGAGAGCTGGTTGGAGAGGG - Intronic
935684404 2:105670837-105670859 CAGAGAGAGGTGGCAGGAATAGG - Intergenic
936014653 2:108948732-108948754 GGGAGAGACCTGGTGGGAGGTGG - Intronic
938264339 2:129915685-129915707 CAGAGAGGCCTGGTGGTAGATGG - Intergenic
938611219 2:132949369-132949391 GAGAGAGAGCTGGTTGGAGGTGG - Intronic
938965464 2:136384416-136384438 GAGGGAATGCTGGTGGGAGTGGG + Intergenic
939045739 2:137247669-137247691 CAGAGACTGCTGCTGGGAATTGG + Intronic
939287999 2:140157309-140157331 CAGAGAGAGCTGTGGGGAAAAGG - Intergenic
941404694 2:165074326-165074348 CCGGGAGAGCTGGTGGGGGGTGG + Intergenic
941866530 2:170340779-170340801 AAGAGAGAGAGGGTGGGAGAAGG + Intronic
942664608 2:178304206-178304228 CTGATACAGCTTGTGGGAGTGGG - Intronic
943628319 2:190223106-190223128 CACTGAGACCTGTTGGGAGTTGG + Intronic
944306541 2:198186241-198186263 GAGAGAGTGGGGGTGGGAGTGGG - Intronic
944389564 2:199203521-199203543 CAGGGAAAGCAGTTGGGAGTGGG - Intergenic
944973498 2:205021053-205021075 CAGAGAAAGGTGATGGGAGATGG + Intronic
946804836 2:223461835-223461857 AAGAGAGAGATGGTGGAAGGAGG - Intergenic
947139432 2:227007946-227007968 CAGAGAGAAATGGCGGGAGAAGG + Intronic
947490683 2:230592014-230592036 CAGAGAGAGAGGGTGGGGGAGGG - Intergenic
947741613 2:232487410-232487432 GGGACAGAGATGGTGGGAGTGGG - Intronic
947756905 2:232572803-232572825 CAGAGAGAACTGCTCGGTGTAGG + Intronic
947831235 2:233143338-233143360 AAGAGAGAGCCGGTGGGGGGCGG + Intronic
947990950 2:234487159-234487181 AAGAGAGAGCGGGTGGGCTTTGG - Intergenic
948160842 2:235822781-235822803 CAGATAGATCTGGTGAGAATGGG + Intronic
948250199 2:236521658-236521680 GAGAGAGAGATGGAGGGAGGAGG + Intergenic
948250843 2:236527640-236527662 CAGACAGGGCTGGTAGGAGCGGG - Intergenic
948477279 2:238228104-238228126 AAGAGAGAGCTGGTGAGATGGGG + Intronic
1168888432 20:1276401-1276423 CAGAGAGCGCAGGTTGGAGTTGG + Intronic
1169045260 20:2530015-2530037 CAGAGGGGGCTGGAGGGTGTTGG + Intergenic
1169528287 20:6454709-6454731 CAGAGAGTGCTGGCAGAAGTAGG - Intergenic
1169835525 20:9873677-9873699 AAGAGAGAGATGGGGTGAGTGGG - Intergenic
1170822813 20:19768444-19768466 CAGAGAGAGCTGGAAGCACTTGG - Intergenic
1171202867 20:23255940-23255962 CAGGGAGAGCTGCTGGGTGTGGG + Intergenic
1173139990 20:40473467-40473489 AAGAGAGACCTTGTGGGAGGAGG - Intergenic
1173438081 20:43050460-43050482 GAGGGAGAGCTGGTGGTAGATGG - Intronic
1175202782 20:57289699-57289721 CAGAGAAAGCTGGTGGGCCAGGG + Intergenic
1175771188 20:61625462-61625484 CAAAGAGCGCATGTGGGAGTCGG + Intronic
1175872576 20:62215478-62215500 CAGAGAGAGTTGGTGGGAAGAGG + Exonic
1176207011 20:63894732-63894754 AACAGGGAGCTGGTGGGAGACGG - Intergenic
1176235951 20:64053610-64053632 CACAGGGGGCTGGTGGGGGTGGG + Intronic
1176590874 21:8649820-8649842 CAGAAAGAACTGTTCGGAGTTGG - Intergenic
1177859447 21:26435728-26435750 CAGAGACAGCTGATTGGAGTTGG + Intergenic
1178357583 21:31921521-31921543 GAGGGAGAGCTGGGAGGAGTTGG + Intronic
1178522607 21:33299115-33299137 CAGAGGGAGGGGGTGCGAGTGGG - Intergenic
1178633935 21:34286113-34286135 CAAAGAGGGATGGTGGGAGTGGG - Intergenic
1178724021 21:35035395-35035417 CAGAGAGGCCAGATGGGAGTGGG + Intronic
1178830581 21:36053269-36053291 ATGAGAGAGCTGGAAGGAGTTGG + Intronic
1179465544 21:41569229-41569251 CTGACAGAGCTGCTGGGAGTGGG + Intergenic
1179524474 21:41966874-41966896 GAGAGAAGGCTGGTGGGATTTGG - Intergenic
1179525387 21:41972735-41972757 GAGAGGGAGATGGTGGGATTGGG + Intergenic
1180273702 22:10626853-10626875 CAGAAAGAACTGTTCGGAGTTGG - Intergenic
1181850931 22:25749470-25749492 CAGAGAGAGGTGGGTAGAGTGGG + Intronic
1182087270 22:27569728-27569750 CAGAGAGTGCTGATGGCTGTTGG - Intergenic
1183242047 22:36664981-36665003 CAGAGGAAGCTGGCGAGAGTGGG + Intronic
1183521565 22:38298698-38298720 CAGAGTGAGCTGGTGGCGGGAGG - Intronic
1183669211 22:39262501-39262523 CAGAGAGAGGTGGGGCGGGTGGG - Intergenic
1183746458 22:39694657-39694679 CAGAGAGAGAGGATGGGAGCGGG - Intergenic
1183912760 22:41091821-41091843 GAGAGAGAGCGGGCGAGAGTGGG + Exonic
1183912772 22:41091881-41091903 CAGAGAGTGCGGAGGGGAGTCGG + Exonic
1184039205 22:41933349-41933371 CAGGGAGAGGGGGTGGGGGTGGG + Intergenic
1184302057 22:43567159-43567181 CATAGAGAGCTGGGAGGAGGAGG - Intronic
1184425305 22:44405807-44405829 CAGAGAGAGCAGGTGGGCCCAGG + Intergenic
1184431437 22:44443457-44443479 GAGAGGGAGGTGGTGGGAGCAGG + Intergenic
1184461549 22:44640635-44640657 CAGTGATGGCTGGTGGGAGCTGG - Intergenic
1184552019 22:45209548-45209570 CAGAGAGAGCGGGCAGCAGTGGG - Intronic
1184730322 22:46368047-46368069 CAGACAGAGCTCGTGTTAGTGGG + Intronic
1184954067 22:47870504-47870526 CAAAGGCAGGTGGTGGGAGTGGG + Intergenic
1185171198 22:49295599-49295621 TAGGGAGAGATGGTGGGAGGCGG - Intergenic
1185305744 22:50114932-50114954 GAGAGAGAGCAGCTGGAAGTAGG - Intronic
1185382372 22:50515853-50515875 GAGAGAGAGCTGGTCGGGTTGGG + Intronic
1185415903 22:50710174-50710196 CAGAGAAAGCAGGTGCAAGTCGG + Intergenic
949136392 3:571863-571885 CAGAAAGAACTGTTTGGAGTTGG + Intergenic
949266379 3:2161402-2161424 CAGAGAGAACTGCTTGGGGTCGG + Intronic
949571512 3:5297997-5298019 AGGAGAGAGCTGGAGGGAGTGGG + Intergenic
950197922 3:11022284-11022306 TACACAGAGCTGGTGGGAGCCGG - Intronic
950380366 3:12608558-12608580 CAGAATGAGCAGGTAGGAGTAGG - Intronic
950457182 3:13099778-13099800 CAGAGAGAGGAGCTGGGGGTAGG - Intergenic
950609992 3:14120355-14120377 CAGGGAGTGATGGTGGGAGATGG - Intronic
950720845 3:14881606-14881628 CAGAGAGAGCTCAAGGGAGCAGG - Intronic
951050472 3:18088004-18088026 AAGAGAGAGCTGGAGTGAGCTGG + Intronic
951924309 3:27890486-27890508 CAGAGAGAGCGAGAGGGAGAGGG - Intergenic
952070171 3:29625066-29625088 GAGACAGAGAGGGTGGGAGTGGG - Intronic
952189063 3:31002734-31002756 AAGTGAGGGCTGGAGGGAGTGGG + Intergenic
952495631 3:33913615-33913637 GAGAGAGAGATGTAGGGAGTGGG - Intergenic
953363459 3:42321759-42321781 GACAGAGAGCTGGTGGCAGAAGG - Intergenic
953412130 3:42696630-42696652 TGGAGAGAGGTGGTGGGAGGAGG - Intronic
954111414 3:48435429-48435451 CAGAGAGACCTGGAGGATGTAGG - Intronic
954388730 3:50258077-50258099 CACATGGAGCTGGTGGTAGTGGG - Intronic
955209810 3:56930049-56930071 CAGCCACAGCTGGTGGGAGGGGG - Intronic
955333066 3:58063368-58063390 CAGAGAGCTCTGTTGGGATTGGG + Intronic
955493883 3:59510986-59511008 CTGAGGGTGTTGGTGGGAGTGGG + Intergenic
955660541 3:61294362-61294384 CAGACAGAAATGGTGGCAGTGGG - Intergenic
956144433 3:66178038-66178060 CTGAGACAGCTCGTGGGAATTGG + Intronic
956409040 3:68959666-68959688 CACAGAAACCTGGTTGGAGTTGG - Intergenic
956693155 3:71896207-71896229 CAGAAAGAGATGGTTGGATTTGG - Intergenic
956740105 3:72269102-72269124 GAGGGTGAGCAGGTGGGAGTAGG - Intergenic
957051576 3:75415962-75415984 CAGAGCGGGATGCTGGGAGTAGG + Intergenic
957966202 3:87324453-87324475 CATGGAGAGCTGGCTGGAGTTGG + Intergenic
957978784 3:87481156-87481178 GAGAGTGAAATGGTGGGAGTTGG - Intergenic
958710480 3:97711070-97711092 GGGAGGGAGCTGGTGGGAGGTGG + Intronic
960588866 3:119346163-119346185 CAGTCAGAGCTGCTGGGAGTGGG - Intronic
960939743 3:122925850-122925872 CAGAGGGAGGGGGTGGGAGGAGG + Intronic
961103022 3:124217986-124218008 GAAAGAGAGCAAGTGGGAGTGGG + Intronic
961654483 3:128433584-128433606 CAGAGAGGACTGGTGGGCTTAGG + Intergenic
962072377 3:132045042-132045064 GGGAGAGAGATGGTGAGAGTGGG + Intronic
962938683 3:140105820-140105842 CAGAGAGGGCTGCTGTGGGTTGG + Intronic
963035216 3:141019828-141019850 CAGGGAGAGCTGGTGGGCAGAGG + Intergenic
963093590 3:141511062-141511084 CAAAGAGAACTGGTTGGATTTGG + Intronic
963250686 3:143100402-143100424 CTAAGAGAGGTGGTGGCAGTTGG - Intergenic
963251047 3:143103897-143103919 CAGAGAGAGGATGTGGGGGTGGG - Intergenic
963347734 3:144115932-144115954 CAGACAGGGCTTGTGGGAGTGGG + Intergenic
963536324 3:146533402-146533424 CAGAGAGAGAGAGTGAGAGTGGG - Intronic
964148687 3:153497763-153497785 CAGCGAGAGCTGAGGGGAGAGGG - Intronic
964426909 3:156563169-156563191 TAGAGGGAGGTGGTTGGAGTTGG - Intergenic
965203768 3:165693984-165694006 GGGAGGGAGCTGGTGGGAGGTGG - Intergenic
966665259 3:182464598-182464620 GAGAGATAGCTTCTGGGAGTAGG + Intergenic
966916230 3:184585592-184585614 CAGAGAGACCTGAATGGAGTTGG - Intronic
967087388 3:186108124-186108146 CAGGGAGAGATGTTGGGGGTGGG - Intronic
968669794 4:1843047-1843069 CACAGAGAGCTGATGGAAGCAGG - Intronic
969154893 4:5201835-5201857 CAAAGGGACCTGGTGGGAGGAGG - Intronic
969294323 4:6260762-6260784 AAGCCAGAGCTGGTGGGAGAGGG - Intergenic
969828315 4:9775635-9775657 AAGAGAGAGTCGGTGGGTGTGGG - Intronic
970473550 4:16400242-16400264 GAGAGAGAGATGGAGGGAGACGG + Intergenic
970564691 4:17320371-17320393 CAAAGACAGCTGGTGGGGGGTGG + Intergenic
970950733 4:21752483-21752505 GGGAGAGACCTGGTGGGAGGTGG - Intronic
971426808 4:26524183-26524205 CTGAGGGAGCTGGGGGGAGCTGG - Intergenic
972312766 4:37896219-37896241 CTCAGAATGCTGGTGGGAGTGGG - Intronic
972370416 4:38418633-38418655 GGGAGAGACCTGGTGGGAGTTGG - Intergenic
972721411 4:41702897-41702919 CAAGAAGAGCGGGTGGGAGTGGG + Intergenic
972910857 4:43814723-43814745 GAGAGAGAGGTGGTGGGAAAAGG - Intergenic
973572554 4:52255480-52255502 TAGAGAGAGATGGTGTCAGTGGG + Intergenic
973602948 4:52560001-52560023 TAGAGAGGGGTGGGGGGAGTTGG - Intergenic
974286225 4:59871293-59871315 CAAATAGAGTTGGAGGGAGTTGG - Intergenic
974425679 4:61740368-61740390 CTGATACAGCTGGTGGGAGGGGG + Intronic
977613624 4:99062849-99062871 CAGAGGGAAATGGTGGGAATGGG + Intergenic
977705786 4:100068553-100068575 CATGGAGAGCTGGTGGAAGCTGG - Intergenic
977962792 4:103104486-103104508 CATAGAGGGGTGGTGGGGGTAGG - Intergenic
978256127 4:106694712-106694734 GAGAGAGAGGTGGTGGGAGGGGG - Intergenic
978390781 4:108223038-108223060 CTTAGAGACCTGGTGGGAGCAGG - Intergenic
978628612 4:110716646-110716668 CAGAGAGGTGTGGTGGGTGTGGG + Intergenic
979047974 4:115894090-115894112 CAAAGAGAAGTGGTGGGAATGGG - Intergenic
979444172 4:120791687-120791709 CAGTGAGAGTTGGTGGTGGTTGG - Intronic
979960212 4:127009939-127009961 GAGAGAGAGCGGGTGGTAGCTGG + Intergenic
980106660 4:128594721-128594743 CAGAGTAAGCTGGAGGGAGGGGG - Intergenic
980136001 4:128859014-128859036 ATGAGACAGCTGGTGGGATTTGG + Intronic
980300891 4:130992138-130992160 CAGAAATAGCTGGTTGTAGTCGG + Intergenic
982159956 4:152558527-152558549 CAGAGATAGCTGAAGGGAGAAGG - Intergenic
985629587 5:1007780-1007802 CAGAGAGACCGGGTGGGACCTGG + Intergenic
986196961 5:5546211-5546233 AGGAGAGGGCTGGTGGGAGAGGG - Intergenic
986369147 5:7062827-7062849 CAGAGAGAGGGGGTGGGTGGGGG + Intergenic
986501956 5:8410080-8410102 CAGAAAGAACTGGTGGGAATAGG + Intergenic
988208355 5:28170491-28170513 CAGAGAGAGGTGGTGGAGATTGG + Intergenic
988403931 5:30799840-30799862 AAGAGTGAGAAGGTGGGAGTGGG - Intergenic
988798427 5:34673942-34673964 CAGAATGACCTGGTTGGAGTGGG + Intronic
989009590 5:36855239-36855261 CTGAGAGAGCACGTGGGACTTGG + Intergenic
989533903 5:42541454-42541476 CAGAGATAGTGGGTGAGAGTGGG + Intronic
990030278 5:51251103-51251125 CAGTGAGAGTTCGTGGGCGTAGG - Intergenic
990181706 5:53167910-53167932 CAGAGACAGCTGGAGAAAGTTGG + Intergenic
990507073 5:56455599-56455621 CAGAGAGAGAAGGAGGGACTTGG - Intergenic
991269635 5:64764577-64764599 CAGAGAGAGATGGGGAGACTTGG + Intronic
992493387 5:77267649-77267671 CCAAGAGAGCTGGTGAGAGTTGG - Intronic
993050014 5:82915614-82915636 AAGAGAGAGGGGGTAGGAGTTGG - Intergenic
993301232 5:86213569-86213591 CAGAGGGTGGTGGTGGGAGGAGG - Intergenic
994817936 5:104608736-104608758 AAGAGGAATCTGGTGGGAGTGGG - Intergenic
994916868 5:105991942-105991964 CAGAGAGAGATGGTGAGGGAGGG + Intergenic
994985538 5:106928433-106928455 CAGAAAGAGCTGGGGGAAGATGG + Intergenic
995326039 5:110891417-110891439 CAGAGAGATCTGCTGTTAGTTGG + Intergenic
995418504 5:111936222-111936244 GGGAGAGACCTGGTGGGAGGTGG + Intronic
996017831 5:118560590-118560612 CAGAGACTGCTGGTGCAAGTGGG + Intergenic
996074125 5:119169341-119169363 CAGAGAGATGTGGTTGGATTTGG + Intronic
996176474 5:120365754-120365776 GACAGAGAGGTGGTGGGACTAGG + Intergenic
996909016 5:128634475-128634497 CAAAGAGGGGTGGTGGGGGTTGG + Intronic
997309620 5:132868896-132868918 CACCGAGAGATGGTGGGGGTAGG + Intergenic
998340774 5:141415442-141415464 GAGAGAGACCTCGTGGGAATAGG - Exonic
998341745 5:141423485-141423507 GAGAGAGACCTCGTGGGAATAGG - Exonic
998627912 5:143866543-143866565 CAAAGAAAGTTGGTGGAAGTGGG + Intergenic
998681700 5:144474726-144474748 AAGAGAGGGCTGCTGGGAGCAGG - Exonic
999492602 5:152066081-152066103 CAGAGAGAGATGGACAGAGTGGG - Intergenic
999563875 5:152835917-152835939 AAGAGAGGGCTGGTGGGAGTTGG + Intergenic
999708749 5:154297513-154297535 CTCTGAGAGCTGGTGGGACTTGG + Intronic
999747617 5:154604266-154604288 CAGAGAGGGCTGCTGGGTGCTGG + Intergenic
1000418336 5:161008074-161008096 CAGAGAGAACTGGCTTGAGTTGG - Intergenic
1001892355 5:175350183-175350205 CAGAGAGAGCTGCTGAGGGAGGG - Intergenic
1001964038 5:175897665-175897687 CAGAGAAAGCTGGTGTGGGGAGG + Intergenic
1002001279 5:176197578-176197600 CAGAGGGAGGTGGGGGGAGGGGG - Intergenic
1002097660 5:176840904-176840926 CACAGAGAGCTGCTGGCAGTGGG + Intronic
1002138625 5:177124746-177124768 CAAAGAGAGCAGCTGTGAGTGGG - Intergenic
1002253060 5:177941391-177941413 CAGAGGGAGGTGGGGGGAGGGGG + Intergenic
1002713113 5:181206844-181206866 CTGGGAGAGCTGCTGAGAGTAGG + Intergenic
1003881155 6:10481007-10481029 AAGAGAGGGTTGGTGGAAGTGGG - Intergenic
1005124271 6:22428487-22428509 CAGAGAGAGCTAGAGAGAGATGG - Intergenic
1006339046 6:33435987-33436009 CAGAGGGAACTGGTGGCAATGGG + Intronic
1006711466 6:36076028-36076050 GAAATAGAGATGGTGGGAGTGGG + Intronic
1006831382 6:36970300-36970322 CACACAGAGCAGGTGGGAGGGGG + Intronic
1007354486 6:41302752-41302774 GGGAGAGACCTGGTGGGAGGTGG + Intergenic
1007359552 6:41345334-41345356 CAGAGAGAGCTGGTGGGAGTGGG - Intronic
1007447752 6:41920402-41920424 CAGACAGGGTTGGAGGGAGTGGG - Intronic
1008743645 6:54642075-54642097 CAGAGAGAGAGGGAGGGAGGGGG - Intergenic
1008960600 6:57261848-57261870 GAGAGAGACCTGGTGAGAGCTGG - Intergenic
1010399520 6:75432456-75432478 CAGAGAGAGCTGGAGAAATTAGG + Intronic
1011982000 6:93390594-93390616 CATACAGGGCTGGGGGGAGTGGG + Intronic
1013112070 6:107072116-107072138 CAGTGAGCGCTGGTGGGTGTCGG + Intronic
1015465418 6:133543352-133543374 CAGAGGGAGGTGGTGGGAATGGG + Intergenic
1015510142 6:134030299-134030321 CAGAGGGTGGAGGTGGGAGTGGG + Intronic
1015640720 6:135328575-135328597 GAGAGAGACCTGGTGGTAGGGGG - Intronic
1016940954 6:149482521-149482543 CAGAGCGGGCTGCTGGGGGTGGG + Intronic
1017174884 6:151493870-151493892 CAGGGCGACCTGGGGGGAGTCGG - Intergenic
1017362173 6:153587502-153587524 GGGAGAGATCTGGTGGGAGGTGG + Intergenic
1017772450 6:157653616-157653638 CAGAGTGACATGGTAGGAGTGGG + Exonic
1017797880 6:157864235-157864257 CAAAAAGGGCTCGTGGGAGTGGG - Intronic
1017892918 6:158654157-158654179 CAGAGAGGGCTGGTGGGACCAGG - Intronic
1017953512 6:159158900-159158922 AAGAGAGGCCTGGTGGGAGGTGG - Intergenic
1017988131 6:159462641-159462663 CCAAGAGAGCTGGAGGAAGTGGG + Intergenic
1018075295 6:160207146-160207168 CAGTGAAAGCAGGAGGGAGTTGG - Intronic
1019175574 6:170157711-170157733 CACAGAGAGATGGCGGGAGAGGG + Intergenic
1019175602 6:170157835-170157857 CAGAGAGAGATGGTGGGAGGGGG + Intergenic
1019528535 7:1492448-1492470 GAGTGACAGCTGGTGGGAATGGG + Intronic
1020340174 7:7101519-7101541 CAGAGGGAGCAGGAGGGAGTAGG - Intergenic
1020755547 7:12197984-12198006 CAGAGGAGGCTGGTGGGAGAAGG - Intergenic
1021084813 7:16409455-16409477 CAGAGAGACCAGGTAGGAGGTGG + Intronic
1021201445 7:17732352-17732374 CAGAGTGAGCTGGTTGGCATTGG + Intergenic
1022102593 7:27177390-27177412 CAGCAAGCCCTGGTGGGAGTTGG - Intronic
1022193658 7:28042377-28042399 GAGGGGGAGCTGGGGGGAGTTGG + Intronic
1022294113 7:29033705-29033727 AGGAAAGAGCTGGTTGGAGTTGG + Intronic
1022384299 7:29887469-29887491 CAGAGAAGGCTGGAGGAAGTAGG + Intronic
1023017318 7:35981362-35981384 TAGAGAGATCTGGTCTGAGTGGG - Intergenic
1023358727 7:39394540-39394562 CAGAGAAAGAAGGTGGGAGAAGG - Intronic
1024685979 7:51745486-51745508 CAGAGAGAGATGGAGAGAGGTGG + Intergenic
1025939264 7:66062199-66062221 GGGAGAGAGCTGGTGGGAAGTGG - Intergenic
1026127300 7:67590213-67590235 CAGAGAGGGCTTCTGGGAGGAGG - Intergenic
1026146637 7:67752226-67752248 AAGAGAGAGATGCTGGGACTGGG - Intergenic
1026208451 7:68280039-68280061 CAGAGAGAGCTGCCCGGAGATGG + Intergenic
1026491863 7:70870469-70870491 CGGAGGGCGCTGGTGGGAGGAGG - Intergenic
1026837142 7:73646926-73646948 CAGAGGGACTTGGTTGGAGTGGG + Intergenic
1026876910 7:73884688-73884710 CAGTGAAAGCTGATGGGAGGAGG - Intergenic
1027319434 7:77002826-77002848 CAGGGAGAGCAGCTGGGGGTCGG - Intergenic
1027341302 7:77210938-77210960 GAGAGGGACCTGGTGGGAGCTGG - Intronic
1029936777 7:104433366-104433388 CAGAGAGCCCTGGGGGGAGTGGG - Intronic
1030070252 7:105692149-105692171 CAGAGAGAACTGGTTGGGGGAGG + Intronic
1030116868 7:106068668-106068690 CTGGGAGAGCAGGTGGGAGGTGG - Intergenic
1031148400 7:118023815-118023837 CAGAGAGAGATGGAGAGAGAGGG + Intergenic
1031949411 7:127876501-127876523 CAGATAGGGCTGTTGGGAGGAGG + Intronic
1032090492 7:128909297-128909319 CAGAGAGAGGAGGAGGGAGAGGG + Intronic
1032481009 7:132247072-132247094 CAGAGAAACCAGGTGGGAGTTGG - Intronic
1032673714 7:134108943-134108965 CAGAGAAAACTGGTAGGATTGGG + Intergenic
1033581983 7:142746331-142746353 GAGAAAGATCTGGTGGGATTTGG + Intergenic
1033662143 7:143409357-143409379 CAGGGAGAGCTGGTGTGACCTGG + Intergenic
1034164438 7:149014630-149014652 GAAAGAGAGGTGGTCGGAGTGGG - Intronic
1034219084 7:149430758-149430780 AAGAGAGAGCTGGAGGGAGATGG + Intergenic
1035117541 7:156537244-156537266 CTGATAGAGCTGGGGGGTGTTGG - Intergenic
1035242942 7:157543980-157544002 CAGAGAGAGGTGGAGAGAGATGG + Intronic
1035242947 7:157544020-157544042 CAGAGAGAGGTGGAGAGAGACGG + Intronic
1035587157 8:785533-785555 CAGAGAGACCTGAGGGGAGGAGG - Intergenic
1036013853 8:4758819-4758841 GGGAGAGACCTGGTGGGAGGTGG - Intronic
1037271099 8:17131455-17131477 CAGAGGGAGCTGGTGGTGGCTGG + Intergenic
1037632399 8:20670148-20670170 CATAGAGAGCTGGTGAAGGTGGG + Intergenic
1037703491 8:21295988-21296010 GAGTGAGAGCTGGGGGGAGAGGG - Intergenic
1037703498 8:21296012-21296034 GAGTGAGAGCTGGGGGGAGAGGG - Intergenic
1037703800 8:21298155-21298177 CAGAGAGGGCTGTGGGGAGCGGG + Intergenic
1037767727 8:21782323-21782345 GAGAGGGAGGTGGTGGGAGGAGG - Intronic
1037948034 8:23001302-23001324 AAGAGAGAGCCGGAGGGAGAGGG + Intronic
1038010479 8:23471889-23471911 CAGAGAGAGGGGATGAGAGTAGG + Intergenic
1038210116 8:25510209-25510231 CAGAGAGAGCTGCAGAGAGGAGG - Intergenic
1038336361 8:26648915-26648937 CAGTGAGTGGTGGTGGGAGAGGG - Intronic
1039269782 8:35868261-35868283 CAGAGAGTGCTGGGTGGAGAGGG - Intergenic
1039475095 8:37835466-37835488 CAGTGAGAGGAGGTGGGAGGAGG + Intronic
1039548942 8:38429623-38429645 CAGAGAGGGCTGGAGGGGGTGGG + Intronic
1039573772 8:38607259-38607281 CAGAGAGATCTGTGTGGAGTAGG - Intergenic
1039828924 8:41197533-41197555 GGGAAAGAGCAGGTGGGAGTAGG - Intergenic
1040544826 8:48390842-48390864 AAGAGAGAAGTGGTGGGAGGTGG - Intergenic
1041110015 8:54475246-54475268 CAGAGAGTGTTGGTGAGACTGGG + Intergenic
1043922449 8:85998867-85998889 GAGAGTGAGATGGTGGGGGTGGG - Intronic
1044826772 8:96205979-96206001 TAGAGAGTGGTGGTGGGAGTTGG - Intergenic
1045560917 8:103261713-103261735 CAGAGGGATGGGGTGGGAGTGGG + Intergenic
1046620884 8:116528479-116528501 GAGAGAAAGCTGCTGGGGGTGGG - Intergenic
1047565051 8:126034972-126034994 CAAAGACAGGTGCTGGGAGTGGG + Intergenic
1047797029 8:128268005-128268027 AAAAGAGAGAGGGTGGGAGTGGG - Intergenic
1047905283 8:129466525-129466547 GAGGGTGAGCTGGTGGGAGGAGG - Intergenic
1049004218 8:139844675-139844697 CATGGACTGCTGGTGGGAGTGGG + Intronic
1049378388 8:142300325-142300347 CAGAGAGAGGTGGTTAGAATGGG + Intronic
1049410130 8:142470189-142470211 CAGAGAGAGCCGGCAGGAGAGGG - Intronic
1049439897 8:142604526-142604548 CAGAGAGAGGTGGTGGTCGAGGG + Intergenic
1050315832 9:4399957-4399979 CAGAAATAGGAGGTGGGAGTGGG + Intergenic
1050978542 9:11975986-11976008 CAGAGAGAGTTGGTGGCAGGTGG + Intergenic
1052900698 9:33792302-33792324 GAGAAAGATCTGGTGGGATTTGG + Intronic
1053291498 9:36882422-36882444 TAGGGAGAGCTGGCTGGAGTCGG - Intronic
1054356967 9:64071194-64071216 CAGTGAGGGCTGGTGGGGGAAGG + Intergenic
1056320269 9:85429137-85429159 CAGAGAAAGCTGGTGTCGGTGGG + Intergenic
1057993070 9:99793381-99793403 GGGAGAGACCTGGTGGGAGGTGG + Intergenic
1058875410 9:109239880-109239902 TAGAGAGAAGTGGTGGCAGTGGG - Intronic
1059209891 9:112503703-112503725 CAGATAATGCTGGTGGTAGTGGG + Intronic
1059498344 9:114729243-114729265 CAGACAGAGTTGGTGGAAGCAGG - Intergenic
1059979315 9:119752345-119752367 CACAGAGAGCTTGGGGGAGCTGG - Intergenic
1060389529 9:123267370-123267392 CAGAGAGAGGTGGGGACAGTAGG - Intronic
1060974410 9:127755813-127755835 GGGAAAGAGCTGGTGGGAGTGGG - Intronic
1061060345 9:128247054-128247076 CGGAGAAAGCTGGTGGGATCTGG + Intronic
1061235098 9:129337490-129337512 CAGAGAGAGTGGGTGGGGATTGG + Intergenic
1061287251 9:129631108-129631130 CAGGGAGTGCTGGAGGGGGTGGG - Intronic
1061400527 9:130365840-130365862 GAGAGAGAGTTAGTGGGGGTGGG - Intronic
1061433690 9:130547293-130547315 CAGAGAGTGCTAGAAGGAGTGGG - Intergenic
1061708996 9:132474595-132474617 CAGATGGAGCTGCTGGGGGTTGG + Intronic
1061747890 9:132753508-132753530 CAGAGAGAGCTCATGAGTGTGGG + Intronic
1061940872 9:133883096-133883118 CAGAGAGAGCAGCAGGGGGTGGG - Intronic
1062111273 9:134783321-134783343 CAGAGAAAGCCGGTGGGTGCTGG + Intronic
1062601322 9:137319858-137319880 GACAGAGAGCTGTTGGGAGAGGG - Intronic
1203561214 Un_KI270744v1:60087-60109 CAGTGAGGGCTGGTGGGGGAAGG - Intergenic
1203620888 Un_KI270749v1:128544-128566 CAGAAAGAACTGTTCGGAGTTGG - Intergenic
1185966824 X:4614916-4614938 CAGAGAGAGGAGGGGGGAGAGGG + Intergenic
1187385547 X:18845139-18845161 TAGAGAGAGGTGGTGGGGGTAGG - Intergenic
1187417083 X:19102745-19102767 CAGAGAGAGGTGGGGGAAGCGGG - Intronic
1188771425 X:34158452-34158474 CAGAGAGAGCTGCTTAGAGAAGG - Intergenic
1188960327 X:36483354-36483376 CAGAGAGAGCTGGTAGTGTTAGG - Intergenic
1189138532 X:38576619-38576641 GAGAGAGAGCTTGTGGGGCTGGG + Intronic
1189577054 X:42365219-42365241 GGGAGGGAGCTGGTGGGAGGTGG - Intergenic
1189630027 X:42943003-42943025 CAAAGAGAGGTGGTGGGGGTAGG + Intergenic
1189630836 X:42951714-42951736 CAGAGAGGGCTGATTGGTGTTGG - Intergenic
1191929845 X:66359241-66359263 CAGTGTGAGGTGGGGGGAGTAGG + Intergenic
1193531597 X:82660862-82660884 CAAAGAGGGATGGTGGGGGTGGG + Intergenic
1194385939 X:93255323-93255345 CAAAGAGAGGTGATGTGAGTGGG + Intergenic
1195939171 X:110153191-110153213 CAGAGGCAGCTGGCGGGAGCTGG - Intronic
1196629859 X:117926265-117926287 CAGACAGAGGTGCAGGGAGTGGG + Intronic
1197527291 X:127578264-127578286 CAGTGAGTGGTGGTGGGAGAGGG - Intergenic
1197537312 X:127706814-127706836 CAAAGAGGGGTGGTGGGGGTGGG - Intergenic
1197644554 X:129003900-129003922 AAGAGAGAGAGGGTGGGACTGGG - Intergenic
1198659406 X:138951207-138951229 CAGAGTAAGCTGATGGGAGGCGG - Intronic
1199158400 X:144577387-144577409 CAGAAGCAGCGGGTGGGAGTGGG + Intergenic
1199927813 X:152487179-152487201 CAGACTGAGCTGGTGGAAGCTGG - Intergenic
1200133081 X:153862092-153862114 CAGAGTGCGATGCTGGGAGTGGG + Exonic
1200160589 X:154006217-154006239 CAGGGAGACCTGATGGGAGCTGG - Intergenic
1200325753 X:155237135-155237157 CAGAGAGAAGAGGTGGGAGTGGG + Intronic