ID: 1007359729

View in Genome Browser
Species Human (GRCh38)
Location 6:41346342-41346364
Sequence GTGGTGGGAATGAGATTAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 236}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007359729_1007359743 30 Left 1007359729 6:41346342-41346364 CCTCTTAATCTCATTCCCACCAC 0: 1
1: 0
2: 0
3: 14
4: 236
Right 1007359743 6:41346395-41346417 AGTATTGCTTCAACACCACAGGG 0: 1
1: 0
2: 2
3: 11
4: 125
1007359729_1007359742 29 Left 1007359729 6:41346342-41346364 CCTCTTAATCTCATTCCCACCAC 0: 1
1: 0
2: 0
3: 14
4: 236
Right 1007359742 6:41346394-41346416 CAGTATTGCTTCAACACCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007359729 Original CRISPR GTGGTGGGAATGAGATTAAG AGG (reversed) Intronic
900727090 1:4223841-4223863 GTGGGGGGAATTACATTGAGTGG + Intergenic
901401301 1:9016809-9016831 GTGGAGGGAAAGAGGATAAGAGG - Intronic
901635492 1:10668379-10668401 GTGGCGGGAAGGAGATGAAAGGG - Intronic
902592390 1:17484377-17484399 GTGATGGGGAGGAGATGAAGAGG + Intergenic
902790590 1:18765260-18765282 GTGGTGGCAATGAGGTGGAGAGG + Intergenic
903094449 1:20956493-20956515 GTGGTGGGAATGAGTCAAATGGG + Intronic
903174543 1:21573123-21573145 GTGGTGGGAATGAAAATGAAAGG + Intronic
903997675 1:27317918-27317940 ATGGTGGGGAGGAGATTAAGGGG - Intergenic
906309957 1:44746688-44746710 GTGATGAGAATGAGGTGAAGAGG - Intronic
907423502 1:54363529-54363551 GTGGTTGGTGTGAGAGTAAGGGG - Intronic
907786996 1:57622239-57622261 GGGTTTGGAATGAGATGAAGGGG + Intronic
910252667 1:85214144-85214166 TTGGTGAGAATCAGACTAAGAGG - Intergenic
910475231 1:87598767-87598789 GTAGTGGGGAAGTGATTAAGAGG + Intergenic
911018795 1:93365435-93365457 GTGGTGCTAATGACATCAAGTGG - Exonic
911341275 1:96641778-96641800 GTGGTGGGAATTTGATAAAATGG + Intergenic
911702211 1:100966806-100966828 GTGTTTGGAATAAGAATAAGTGG + Intronic
912478255 1:109956908-109956930 ATGGTGGGAATGGGAACAAGAGG + Intergenic
912503211 1:110136259-110136281 GTGTTGGGGATAAGATGAAGAGG - Intergenic
912748582 1:112266790-112266812 GTGGAGGGAATGTGATTGACAGG + Intergenic
913221710 1:116665815-116665837 GAGGTGGAAATGGGAGTAAGTGG - Intronic
913223869 1:116681393-116681415 GGGGTGGGGATGAGATGGAGTGG + Intergenic
915382479 1:155454164-155454186 CTAGTGGGAATTAGAGTAAGTGG - Intronic
915455259 1:156036275-156036297 GAGGAGGGAATGAGATTATTCGG - Exonic
915831817 1:159138348-159138370 GTGAGGGCAATGAGATTTAGGGG - Intronic
916756623 1:167776883-167776905 CTGGTGGGAATGGATTTAAGAGG + Intronic
917766417 1:178223463-178223485 GTGGTGGGAAGGAGAGTGACAGG + Intronic
918325983 1:183411137-183411159 GAGGTGAGAATGAGGTAAAGTGG - Intronic
920164538 1:204026302-204026324 GTGGTGGGAGTGAGAGGCAGAGG + Intergenic
921372923 1:214443975-214443997 GTGGTGGGAGTGAGAGTGGGAGG + Intronic
922060154 1:222081575-222081597 GTGGTGGGAAACAGGTTAAAGGG - Intergenic
922072153 1:222205045-222205067 GTGGTGGAAATGATATGAAAGGG - Intergenic
922361795 1:224829350-224829372 GTGATGGGAATGAGGTCAAGTGG + Intergenic
923259094 1:232249771-232249793 GGGCAGGGAAGGAGATTAAGTGG - Intergenic
924585916 1:245361178-245361200 CAGGTGGGAATGCGATTAATAGG - Intronic
1063082536 10:2782194-2782216 GTGGGGACAATGACATTAAGGGG - Intergenic
1064931124 10:20628429-20628451 GAGGAGAGAAAGAGATTAAGAGG + Intergenic
1068753750 10:60626750-60626772 ACAGTGGGAATGAGGTTAAGAGG + Intronic
1068912595 10:62394829-62394851 GAGGTGGTAATGAGAAAAAGAGG + Intronic
1069764951 10:70848927-70848949 TTAGTGGGATTGAGAGTAAGGGG - Intronic
1071447192 10:85759405-85759427 GTGGTGGGGATCAGCTTGAGTGG - Intronic
1074403981 10:113165108-113165130 GTGGTGGGAATGGGAGTGAAGGG + Intronic
1075510566 10:123069311-123069333 GTGGCGGCAAGGAAATTAAGTGG - Intergenic
1075777325 10:124997272-124997294 GCGGTGGGGTTGAGATTCAGTGG + Intronic
1078390587 11:10932201-10932223 GTGGGGGGAAGGAGATGAGGAGG + Intergenic
1078799380 11:14627671-14627693 GTTGTGAGGATGAGAATAAGAGG + Intronic
1078908050 11:15705720-15705742 GTGGTGAGAATGAGTTGAAAAGG + Intergenic
1078962418 11:16292971-16292993 GTGATTGAGATGAGATTAAGCGG - Intronic
1079278838 11:19070125-19070147 GTGGGGGAAATAAGAATAAGAGG - Intergenic
1080265851 11:30401224-30401246 GTGATGGGAATGAAAATCAGTGG - Intronic
1080275539 11:30499505-30499527 GTGGGAGGAATCAGATTAAGAGG - Intronic
1080662067 11:34304710-34304732 GGGGAGGGAAAGAGACTAAGAGG + Intronic
1081860019 11:46327710-46327732 GGGGTGGGAATGGGATCCAGGGG + Intergenic
1083060675 11:59867543-59867565 GTGGTGGGAAGGAGATGCGGAGG + Intergenic
1084300689 11:68249431-68249453 GTGGAGGTAATGAGATCATGGGG + Intergenic
1084763259 11:71287887-71287909 GGGGTGGGAAGGAGAGAAAGGGG - Intergenic
1085207875 11:74747862-74747884 GCAGTGGGAATGGGATGAAGAGG + Intergenic
1086023905 11:82267087-82267109 GTATTGGGAATGATAGTAAGTGG - Intergenic
1086302174 11:85438828-85438850 GAGGTGGGGATGAGATGAGGTGG - Intronic
1087761003 11:102104426-102104448 ATGGTGAGAAGGTGATTAAGGGG + Intergenic
1091674449 12:2478730-2478752 GTGGTGGGATTGGGATTCATTGG + Intronic
1091818933 12:3459900-3459922 GTGCTGAGAATGAGGTTGAGAGG + Intronic
1092776281 12:11947430-11947452 GTGGTGGGAACAAGATGACGGGG + Intergenic
1092776475 12:11948707-11948729 GTGGTGGGAACGAGATGACGGGG - Intergenic
1095424436 12:42060454-42060476 GTGGTGGGGGTGGGATGAAGGGG - Intergenic
1097171551 12:57117112-57117134 GTGGTGGCTATGAGAGTGAGTGG + Intronic
1098326958 12:69312872-69312894 GTGGTGAAAATGAGAATAGGAGG + Intergenic
1099287396 12:80731495-80731517 TTGTTGGGAATGAGATTTTGTGG + Intergenic
1099488558 12:83257946-83257968 GTGGTTGGAATGGGAATTAGTGG + Intergenic
1102570421 12:113823962-113823984 GTGGAGGGAATGACAATTAGAGG + Intronic
1105566673 13:21556029-21556051 GAGGTGGAAATGCGATCAAGAGG - Intronic
1106205955 13:27594834-27594856 GTGGTGGGAATGGAAGAAAGGGG - Intronic
1107130204 13:36886765-36886787 GAGGTGACAATGAGATCAAGAGG + Intronic
1107416496 13:40206086-40206108 CTGGTGGGAATGAGAGGAATTGG + Intergenic
1108080848 13:46733384-46733406 TTGGTGGGAAGGAGGTTAATTGG + Intronic
1111727287 13:92028735-92028757 GTGGTAAGAATGAGATAGAGAGG + Intronic
1112562253 13:100525449-100525471 GTGGTGGACAGGAGCTTAAGGGG - Intronic
1113350774 13:109526974-109526996 GTTGTTGGAATGAGACAAAGGGG + Intergenic
1116321524 14:43471852-43471874 GTGGTCTGAATGAGTTAAAGAGG - Intergenic
1117665504 14:58052231-58052253 GTGGAGGAAATGAGAATAAGAGG - Intronic
1118073790 14:62276358-62276380 GTGGTGGGAATTGGATCATGAGG - Intergenic
1118979592 14:70705751-70705773 GGGGTGGGCAGGAGATGAAGTGG - Intergenic
1119691223 14:76674224-76674246 GGGTTGGGGATGAGATAAAGTGG - Intergenic
1121482348 14:94288950-94288972 CTGGTGTGAATGAGACAAAGTGG - Intronic
1123007065 14:105329057-105329079 GTGCTGGGAGTGAGATTAGAGGG + Intronic
1123998108 15:25733156-25733178 GTGGTGTGAAGGAGGTTACGGGG + Intronic
1124024441 15:25952065-25952087 TTGGTGGCAATGAAATTCAGTGG - Intergenic
1125069257 15:35532393-35532415 GTGGTGAGAATGAAGTCAAGGGG + Intronic
1128208139 15:65870365-65870387 GTGGTGGGAGGGAGGGTAAGAGG + Intronic
1128756122 15:70185212-70185234 GTGGTGGGAAGGAGAGGAGGAGG + Intergenic
1130561552 15:84963240-84963262 TTGGTGAGCATGAGAGTAAGGGG - Intergenic
1132988328 16:2779594-2779616 GTGGTGGGAATGGGGTCAGGAGG + Intergenic
1134157864 16:11858632-11858654 GTGTTGGGCATGAGATTACAGGG + Intergenic
1134779240 16:16880613-16880635 GTGGTGGGACTGTGAGCAAGGGG - Intergenic
1135189627 16:20344199-20344221 GGGGTGGGGATGAGAGAAAGGGG + Intronic
1141028749 16:80570585-80570607 GTGGTGGGAGTGGGGTTGAGTGG - Intergenic
1141028762 16:80570619-80570641 GTGGTGGGGGTGAGGTTGAGCGG - Intergenic
1145194142 17:20872354-20872376 GAAGGGGGAATGAGATTTAGAGG - Intronic
1149165489 17:53746994-53747016 GAGGTGGAATAGAGATTAAGTGG + Intergenic
1151213309 17:72560776-72560798 GTGCTGGGGATGATATAAAGAGG - Intergenic
1151575947 17:74952676-74952698 GGCGTGGGGATGAGATTCAGGGG + Intronic
1153166420 18:2266836-2266858 CTGGTGGGAATGAGAGATAGGGG + Intergenic
1156661311 18:39349899-39349921 ATTGTGGGAATGAAATAAAGGGG + Intergenic
1157365667 18:47061938-47061960 GGGTTGGGAGAGAGATTAAGTGG + Intronic
1162913177 19:13860905-13860927 GTGGTGGGGAGGGGATTAGGGGG + Intergenic
1164062882 19:21690712-21690734 GTGGTGAGAATGACAGTATGAGG + Intergenic
1164175303 19:22768601-22768623 GTGGTGGCAATGAGATTTCAAGG + Intronic
1165393010 19:35549099-35549121 CTGGTTGGAATGAGTTCAAGGGG + Intergenic
1167217568 19:48174980-48175002 GTAGTGAGAGTGAGATTGAGGGG + Intronic
924999085 2:390946-390968 GTGTTGGGAATGGGATTAACTGG + Intergenic
927009226 2:18884812-18884834 GTGGTGGGTAGGGGATAAAGAGG + Intergenic
930687672 2:54326442-54326464 GTGGTGAGAGTGAGAGCAAGAGG - Intergenic
932774642 2:74520521-74520543 GTGGAGGGAATGAAATGACGTGG + Intronic
932892058 2:75606002-75606024 GTGGTGGGAATGACAGACAGTGG - Intergenic
932896094 2:75641554-75641576 GTGGTGGGGGTGAGCTTATGTGG - Intergenic
932996714 2:76864200-76864222 GTGGTGGGATTCAGATCAAAAGG + Intronic
934853547 2:97715793-97715815 GTGGTGAGAATTAGAATAAATGG + Intronic
937387604 2:121450486-121450508 TTGGTGTGAATCATATTAAGGGG - Intronic
938099031 2:128485664-128485686 GTGGTGGGGATGGTATTCAGTGG - Intergenic
939148754 2:138448261-138448283 GTGGTGGCAATGGTATTGAGGGG - Intergenic
939671804 2:145022174-145022196 GTGGGGGGAAGGAGAGGAAGAGG - Intergenic
940228091 2:151421461-151421483 GTGGAGTGAATGAGAGTGAGAGG + Intronic
940681511 2:156791306-156791328 GAGGTGGGAAAAAGATCAAGAGG + Intergenic
940914106 2:159235749-159235771 CTGTTGGGAATGATAGTAAGAGG + Intergenic
941865828 2:170333346-170333368 ATGGAGTGAATGAGATAAAGAGG + Intronic
943747686 2:191479482-191479504 GTGCTGGAAATGAAATTCAGAGG + Intergenic
944019374 2:195083428-195083450 GTGGTGGGAATGGGGTTGAAAGG - Intergenic
944609660 2:201389427-201389449 GAGCTGGGAATGAGATAGAGCGG + Exonic
946948296 2:224844816-224844838 ATGGTGGGAGTGACATTAAATGG - Exonic
947967963 2:234298030-234298052 TTGGAGGAATTGAGATTAAGGGG + Intergenic
1168761470 20:352992-353014 GAGCTGGGAAGGAAATTAAGAGG + Intronic
1170328547 20:15183030-15183052 GTGGTGGAAATGAGAATGGGAGG - Intronic
1172781022 20:37437176-37437198 GGGGTGGGAGTGAGATTTTGCGG - Intergenic
1173915892 20:46708847-46708869 GGGGTGGGAAGGAGCTTATGGGG - Intergenic
1175914013 20:62417322-62417344 GTGGTGGGAAACAGCTAAAGTGG + Intronic
1177301615 21:19252724-19252746 GTGGGGAGAATGTGATTAATGGG - Intergenic
1178954152 21:37007789-37007811 GTGGTGTGATTGAAATTAACCGG + Intronic
1179346983 21:40567605-40567627 GTAGGGGGAATGAGATGAGGAGG - Intronic
1179437993 21:41375157-41375179 GTGGTGGGCTTGAGATTCTGGGG - Intronic
1181807562 22:25384305-25384327 GTAGTGGGAATGAGAGTGCGGGG - Intronic
1183320585 22:37162947-37162969 GGGGTGGGACTGAAATGAAGTGG - Intronic
1183706978 22:39480272-39480294 GTGGTGGGAAGGAGCTGGAGAGG + Intronic
1185141944 22:49107558-49107580 GAGGTGGGAAAGAGAGAAAGTGG - Intergenic
949588260 3:5465201-5465223 GTGCTAGGAATGACATGAAGTGG + Intergenic
949772611 3:7595594-7595616 ATGGTGGGAAGGAGAGTGAGAGG + Intronic
950615002 3:14151077-14151099 GTGGTGGGGATCAGAACAAGGGG + Intronic
951341348 3:21491193-21491215 GTAGTGGGATTCAGATAAAGGGG + Intronic
951753504 3:26063098-26063120 GCTGTGGAAATGAGATTAAATGG + Intergenic
953660544 3:44888450-44888472 CTGGTGGAAATGAGATGAATGGG + Intronic
954154601 3:48678485-48678507 GTGGGGGGCATGACATTGAGTGG - Intronic
954911946 3:54117910-54117932 GTGGAGGTAATTAGATTATGGGG + Intergenic
957978696 3:87479772-87479794 GTCAAGGGAATGAGATAAAGGGG + Intergenic
958961653 3:100516361-100516383 GTGGTGGTAATGAGTAAAAGAGG + Intronic
959658892 3:108843162-108843184 TTGGTGGGAATGATACAAAGGGG - Intronic
960441836 3:117698039-117698061 GAGGATGGAATGATATTAAGTGG - Intergenic
962005766 3:131348027-131348049 GTTATGGGAATGAGATTATTAGG - Intronic
963505317 3:146177885-146177907 GTGGTGGGAATGACACTGTGTGG - Intergenic
963732166 3:148985158-148985180 GAGGAGGGAATGAGATTATTCGG - Intergenic
963878551 3:150503188-150503210 GTGGTGGGGATGAGTGTCAGAGG - Intergenic
970319279 4:14859922-14859944 GAGGTGGGGAGGAGATGAAGGGG + Intergenic
972170614 4:36341283-36341305 TTGGTGAGGAGGAGATTAAGGGG + Intronic
973889442 4:55354481-55354503 GTAGTGGGAATGAGACCATGAGG - Intronic
975615180 4:76238657-76238679 GTGATGGGAAGGAGAATAGGAGG + Intronic
976208904 4:82647844-82647866 ATGTTGGGAATGATAGTAAGAGG + Intronic
978007426 4:103634364-103634386 GTTGGGGGAATGAGATTGGGAGG + Intronic
980500204 4:133641158-133641180 GTTGTGGGAAAGAGATGAAAAGG + Intergenic
981483222 4:145259099-145259121 ATGGTGGGAATGAGAACAAGAGG + Intergenic
981671356 4:147290846-147290868 GGGATGGGAGTGAGAGTAAGAGG + Intergenic
983163922 4:164451719-164451741 GTGGTGGGAATGAGACTCCTAGG - Intergenic
983494140 4:168424355-168424377 GTAGTGGGATAGAGATAAAGAGG - Intronic
986719826 5:10553004-10553026 GGGGTGGGACTGAGAGAAAGTGG + Intergenic
988396592 5:30704142-30704164 GTGGAGGCAATGAGATCATGGGG - Intergenic
988798374 5:34673738-34673760 GGGGTGGGAATGGGGTTGAGGGG - Intronic
991053739 5:62300161-62300183 GTGGGTGGAATTAGATTATGGGG + Intergenic
992064292 5:73091365-73091387 GAGGTGGGAATGGGATGAAGAGG - Intergenic
992589328 5:78277355-78277377 TTGGTGGGAGGGAGTTTAAGGGG + Intronic
992679607 5:79140994-79141016 GAGGTAGGAATGAGCTTAGGGGG - Intronic
993173163 5:84446910-84446932 GTGAAGGAAAGGAGATTAAGTGG + Intergenic
993476384 5:88370666-88370688 ATGCTGAAAATGAGATTAAGAGG + Intergenic
995504314 5:112843116-112843138 ATAGTGGGACTGAGATTAGGTGG - Exonic
995943663 5:117615459-117615481 TTGATGGGAAAGAGATTAACTGG + Intergenic
995982139 5:118117221-118117243 GTGGTGGGAATGAAGAAAAGTGG + Intergenic
996961272 5:129253351-129253373 GTGGTGGGAAGGAGAGTGTGAGG - Intergenic
999586731 5:153097514-153097536 GTGGTGTGACTGAGACTCAGAGG + Intergenic
999819879 5:155216055-155216077 GTGGTAGCAATGAGATTTGGAGG + Intergenic
1001460688 5:171910677-171910699 GTGGTCTGAATCAGATCAAGTGG - Exonic
1002088191 5:176788945-176788967 GTGGGGGGAATGATCTTCAGAGG + Intergenic
1002198523 5:177513964-177513986 GTGGTGGGAATGATGAGAAGGGG - Intronic
1003120129 6:3312672-3312694 GTGGTTGGAATGAGGACAAGGGG - Intronic
1003593282 6:7453483-7453505 GAAGTGGGATTGTGATTAAGGGG + Intergenic
1005032161 6:21519957-21519979 TTGGTGGGAATGAGAAAAATAGG - Intergenic
1005779484 6:29174266-29174288 GTAGTGAGAATGAGAATGAGAGG - Exonic
1006820393 6:36888910-36888932 GTGGGAGGAATGAGTTGAAGGGG + Intronic
1007299104 6:40852914-40852936 GTGGTGTAGATGAGATGAAGAGG + Intergenic
1007359729 6:41346342-41346364 GTGGTGGGAATGAGATTAAGAGG - Intronic
1010160814 6:72852616-72852638 GTGGAGAGAAGGAGATGAAGGGG + Intronic
1012603023 6:101121267-101121289 TTGGTGGCATTTAGATTAAGCGG + Intergenic
1014298150 6:119646424-119646446 GAGGTGGCAATGAGATAGAGTGG + Intergenic
1014366785 6:120553487-120553509 GTGTTGGAAATGATATGAAGAGG + Intergenic
1014957939 6:127644110-127644132 GTGGGGGGAATGAAGTTAAAGGG + Intergenic
1015156536 6:130102607-130102629 GTGATGGGGATGAGATGAACCGG - Intronic
1017098247 6:150824412-150824434 ATGGTGGAAATGAGATTATAGGG - Intronic
1017126646 6:151070876-151070898 CTGGTGGGAATGAGATAAAAAGG + Intronic
1017485595 6:154899422-154899444 GTGCTGGGAATGAGTCAAAGTGG - Intronic
1018157265 6:160997240-160997262 GTGGTGGGACAGAGATTATGGGG - Intronic
1018445795 6:163857149-163857171 GCTGTGGGGATGAGAATAAGGGG + Intergenic
1021145643 7:17085349-17085371 GGTGTGGGAATGAGCATAAGTGG + Intergenic
1021579250 7:22135094-22135116 GTGGTGGCAATGGGAGGAAGTGG + Intronic
1021640489 7:22731283-22731305 GTGGGGTGAATGAGATTAACTGG - Intronic
1022256220 7:28661072-28661094 GTGGTGGGAATGGGGGTGAGGGG + Intronic
1024342476 7:48281603-48281625 GTGGTGGGAATGAGGTTGGGAGG - Intronic
1024513718 7:50224766-50224788 GAGTTGGGGATGAGATTAATGGG + Intergenic
1024907018 7:54394727-54394749 CTGGTGGGGATGAGTTTCAGGGG + Intergenic
1024978797 7:55138930-55138952 GTGGTGGGGAAGAGAAAAAGCGG + Intronic
1026429138 7:70326339-70326361 CTGGTGGGACAGAGATTAGGTGG - Intronic
1026471863 7:70700583-70700605 CTGGGGAGAAAGAGATTAAGGGG + Intronic
1028421835 7:90641628-90641650 GTGGTGGGGAGGAGATGATGGGG + Intronic
1029513790 7:101013279-101013301 GGGGTGGGAATGAGATTACAGGG - Intronic
1033941524 7:146660930-146660952 GTGGAAGGATTGTGATTAAGTGG + Intronic
1034857283 7:154563536-154563558 GTGGTGGGAAAGAGAAGAAATGG + Intronic
1037723721 8:21466369-21466391 GGGGTGGGAATGGGATTAGAAGG + Intergenic
1038131253 8:24733939-24733961 GTGGTGAAAATGACGTTAAGTGG - Intergenic
1038296340 8:26293672-26293694 GAGGAGGGAATGATATTCAGTGG + Exonic
1038653169 8:29424041-29424063 GTGGTGGGGATGAGATGAACTGG + Intergenic
1039883165 8:41639408-41639430 GTCCTGGGAATGAGGCTAAGAGG - Intergenic
1039966791 8:42289842-42289864 GTGGAGGGCATGAGATTGAAAGG + Intronic
1041190352 8:55347462-55347484 GTTGTTGGATTGAGATTATGTGG + Intronic
1041902651 8:62998793-62998815 GTGGTGGGATTGTGATGCAGTGG - Intronic
1047544726 8:125804533-125804555 GGGGTGGAGATGAGATAAAGGGG + Intergenic
1051349643 9:16186774-16186796 GTGGTGGGTATGGGAGAAAGAGG + Intergenic
1051999040 9:23253928-23253950 GTTGTGGGAATGAGAAGAACAGG + Intergenic
1053629877 9:39925303-39925325 GTCCTGGTTATGAGATTAAGTGG - Intergenic
1053775893 9:41538231-41538253 GTCCTGGTTATGAGATTAAGTGG + Intergenic
1054214010 9:62325399-62325421 GTCCTGGTTATGAGATTAAGTGG + Intergenic
1054850958 9:69846224-69846246 GTGGGGGAAGTGAGATGAAGCGG + Intronic
1055214220 9:73838873-73838895 GTGATGGTAAAGAAATTAAGGGG - Intergenic
1055289538 9:74768683-74768705 GTGGTGGGATTGAAAAGAAGGGG - Intronic
1055365365 9:75538630-75538652 GTGGTAAGAATGAGCTCAAGGGG + Intergenic
1055560046 9:77513647-77513669 GTGGTGCGAAAGAGAGGAAGGGG - Intronic
1057618206 9:96612449-96612471 GTTGTGAGAATGAAATGAAGGGG - Intronic
1058675079 9:107393372-107393394 GTGGTTGGATTGAGACTTAGAGG + Intergenic
1059700290 9:116769363-116769385 GTGGTGGGCGGGAGAGTAAGTGG + Intronic
1186217119 X:7312161-7312183 GAGGTGGGAACAAGATGAAGGGG - Intronic
1193870539 X:86792508-86792530 GTTGGGGGAAGGAGATGAAGAGG - Intronic
1195201015 X:102550089-102550111 GAGGTGGGTAGGAGGTTAAGGGG + Intergenic
1195254481 X:103079295-103079317 GAGGTGGGTAGGAGGTTAAGGGG - Intronic
1195324898 X:103750533-103750555 ATGGTGGAATTGGGATTAAGAGG - Intergenic
1195365031 X:104116891-104116913 GTGATAGGAATGAGATTGTGGGG - Intronic
1196480170 X:116139158-116139180 GTGGGGGGAGTGAGACTGAGTGG + Intergenic
1196591757 X:117493685-117493707 GAGATGGGAATTACATTAAGTGG - Intergenic
1198017789 X:132629456-132629478 GTGGGGGGCATGAAATAAAGTGG - Intronic
1198073057 X:133168699-133168721 GTGTTGGTAATGAGATTCTGGGG - Intergenic