ID: 1007360297

View in Genome Browser
Species Human (GRCh38)
Location 6:41350737-41350759
Sequence CGTGACCTGTTGAAGGTGGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 131}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007360297 Original CRISPR CGTGACCTGTTGAAGGTGGC AGG (reversed) Exonic
900148190 1:1167328-1167350 CGTGACCTTCGGAAGGGGGCTGG + Intergenic
905803683 1:40861563-40861585 CGTGAGCTGCTGAGGGCGGCCGG - Exonic
911360696 1:96873018-96873040 CCTACCCTGATGAAGGTGGCAGG + Intergenic
911606359 1:99909580-99909602 CATTACCTGTTGGAGGTTGCAGG + Intronic
915596929 1:156901347-156901369 CGTGTCCTCTAGAAGTTGGCTGG + Intronic
923328132 1:232898570-232898592 GGTGACATGTAGATGGTGGCAGG + Intergenic
923337063 1:232979710-232979732 GGTGTCCTGGTGATGGTGGCTGG - Exonic
923917987 1:238530307-238530329 GATGACATGTTGATGGTGGCAGG - Intergenic
1067058782 10:43067148-43067170 CGTGACCTGTGCCAGGTGGGAGG - Intergenic
1068556486 10:58464712-58464734 CCTGATCTGGTGGAGGTGGCAGG + Intergenic
1072245578 10:93541240-93541262 CGGGGCCTGTTGAGGGTGGGGGG + Intergenic
1073093880 10:100968573-100968595 TGTGACCTATTAAAGGAGGCAGG + Intergenic
1073645324 10:105295724-105295746 CGTGGCCTGTTGGGGGTGGAGGG - Intergenic
1075712313 10:124537298-124537320 CGTGAGCTGTTGGGGGTGTCAGG + Intronic
1081554087 11:44141636-44141658 CATAGCCTTTTGAAGGTGGCGGG + Intronic
1083870758 11:65487065-65487087 CGTGACCTGCTGAAGGTCCCAGG + Intergenic
1086315633 11:85589055-85589077 CCTGCCCTGTTGGAGGTGGCAGG + Intronic
1086869306 11:92017829-92017851 CCTGCTCTGGTGAAGGTGGCAGG + Intergenic
1086947087 11:92853988-92854010 GATGACATGTTGATGGTGGCAGG - Intronic
1087011742 11:93520834-93520856 CGTGACATGCTGAAGGTGAAAGG - Intronic
1091230160 11:133983079-133983101 CGTGTGCTGATCAAGGTGGCGGG + Intergenic
1094839520 12:34337094-34337116 CGTGGCATGTTGTGGGTGGCGGG - Intergenic
1095649829 12:44594129-44594151 CGGGGCCTGTTGGGGGTGGCGGG + Intronic
1102568212 12:113811115-113811137 CGGGACCTGTTGGGGGTGGAGGG - Intergenic
1103948055 12:124538010-124538032 CGGGACGTGCTGCAGGTGGCTGG - Intronic
1104679322 12:130738400-130738422 CGAGACCTGTCGAGGGTGGAGGG - Intergenic
1109508362 13:63336649-63336671 CCTGTTCTGGTGAAGGTGGCAGG + Intergenic
1113759373 13:112836995-112837017 CGTGACCTGCTGAGGGTGGGGGG - Intronic
1115385276 14:32789447-32789469 CCACACCTGTAGAAGGTGGCTGG - Intronic
1117404475 14:55388341-55388363 CATGACCACTTGCAGGTGGCAGG + Intronic
1121023559 14:90598048-90598070 CGGGACCTCTTGAAGCTGGGTGG - Intronic
1132461791 16:59059-59081 CGGGACCTGGAGAAGCTGGCAGG - Exonic
1132634346 16:936141-936163 CGTGGGCTGAGGAAGGTGGCTGG + Intronic
1132634400 16:936303-936325 CGTGGGCTGAGGAAGGTGGCTGG + Intronic
1132634454 16:936465-936487 CGTGGGCTGAGGAAGGTGGCTGG + Intronic
1136409753 16:30069405-30069427 CCTGACCAGTGCAAGGTGGCTGG + Intronic
1138217119 16:55214288-55214310 TGTCACCTGTTGAAGGAGGAAGG - Intergenic
1140665194 16:77221070-77221092 CTTGACTTATTGAAGGTGTCAGG - Intergenic
1142931196 17:3285149-3285171 AGAGGCCTGGTGAAGGTGGCAGG + Intergenic
1142944182 17:3411091-3411113 AGAGGCCTGGTGAAGGTGGCAGG - Intergenic
1144506359 17:15834614-15834636 AGTGACCTGTGCAAGGTGGTGGG - Intergenic
1145170536 17:20652547-20652569 AGTGACCTGTGCAAGGTGGTGGG - Intergenic
1147056598 17:37839668-37839690 GGGGACCTGTTGGAGGTTGCAGG + Intergenic
1150490657 17:65572333-65572355 CTTGACCCGTTGAAGCTGGTGGG - Intronic
1152122028 17:78424735-78424757 CGTCAGCTGTTGAAGGGGACAGG + Intronic
1153293194 18:3521370-3521392 CCTGCCCTGCTGAAGGGGGCTGG - Intronic
1155653400 18:28168198-28168220 CTTGACCTGTTGTTGGTGGGTGG - Intronic
1156356816 18:36349145-36349167 CGTGACATGTGGCAGTTGGCAGG + Intronic
1157983892 18:52415488-52415510 TGTGCCATGATGAAGGTGGCAGG + Intronic
1159894734 18:73985560-73985582 TGGGGCCTGGTGAAGGTGGCAGG - Intergenic
1159947075 18:74451765-74451787 CCTTACCTGTGGAAGCTGGCAGG - Intronic
1161704549 19:5813072-5813094 CGTGCCCTATTGAAGATGGGAGG + Intergenic
1162351752 19:10154604-10154626 CGGGACCTGATCAAGCTGGCTGG - Exonic
1162859413 19:13494857-13494879 AGGGACCTGGTGAAGGTGACTGG - Intronic
1164456395 19:28411129-28411151 CGTGAGCACTTGAATGTGGCAGG + Intergenic
1168581500 19:57559327-57559349 CGGGACTTGTTCAAGGTCGCAGG + Intronic
927124772 2:20004072-20004094 GGAGGCCTGTTGAAGGAGGCTGG + Intronic
931150082 2:59563271-59563293 CGTGGCCTGTTGTAGGTGTTTGG - Intergenic
936039050 2:109135295-109135317 CGTGTCCTGGGGGAGGTGGCAGG - Intronic
941929242 2:170924293-170924315 AATGGCCTGTTGATGGTGGCAGG - Intergenic
942182316 2:173391633-173391655 TGTCACCGGTTGAGGGTGGCCGG + Intergenic
943226490 2:185185315-185185337 GATGACATGTTGATGGTGGCAGG + Intergenic
946291667 2:218750058-218750080 CGTGACCTTCTGAATCTGGCAGG + Exonic
946428611 2:219613194-219613216 CTGTACCTGTTGAAGGTGACTGG + Exonic
948245204 2:236476904-236476926 CGGGGCCTGTTGGAGGTGGAGGG - Intronic
948307721 2:236961999-236962021 CGTGACCTGGGGATGGTGGGAGG + Intergenic
1169397856 20:5250701-5250723 CCTGTTCTGGTGAAGGTGGCAGG + Intergenic
1169465847 20:5837468-5837490 CGGGGCCTGTTGGAGGTGGGGGG - Intronic
1170582767 20:17711502-17711524 CCTGACCTGGTGAAGGAAGCAGG + Intronic
1170803423 20:19609569-19609591 CGGGGCCTGTTGGAGGTGGGGGG - Intronic
1170890290 20:20369690-20369712 GGCGAGCTGTAGAAGGTGGCCGG - Exonic
1171983612 20:31644377-31644399 AGTGACTTGTTGAAGGTCGCAGG + Intronic
1172868676 20:38120751-38120773 CCTGACCTGGTGATGGGGGCAGG - Intronic
1179909265 21:44439276-44439298 CGTCACCTGGTGAAGCTGGGTGG - Intronic
1180926282 22:19557305-19557327 ACTGACCTGATGAAGGTGGAGGG + Intergenic
1183035375 22:35137090-35137112 CGTTACCTGTTGAAAGTGCTTGG - Intergenic
1184854900 22:47141323-47141345 AGTGACCTGATCAAGGTTGCAGG - Intronic
950361167 3:12450449-12450471 GGTGACTTGTGGAAGGTGACTGG - Intergenic
950634855 3:14307593-14307615 CGTGTCCTGCTGCAGGTGGGAGG - Intergenic
950679181 3:14573354-14573376 CGGGACCTGGAGAAGCTGGCAGG - Intergenic
952826483 3:37529374-37529396 TGAGACTTGTTGGAGGTGGCAGG + Intronic
955735051 3:62029886-62029908 TGTGACAGGTGGAAGGTGGCCGG - Intronic
956034070 3:65071580-65071602 CGTGAACTGTTGAAACTTGCAGG + Intergenic
956668208 3:71661752-71661774 AGTGACCTGTTGAAAGTGATAGG - Intergenic
959520449 3:107317787-107317809 AGGCACCTGTAGAAGGTGGCTGG + Intergenic
963171196 3:142252691-142252713 CTTGCCCTGGTGGAGGTGGCAGG - Intergenic
977762822 4:100759640-100759662 CGTGCTCTGGTGGAGGTGGCAGG - Intronic
981254309 4:142643502-142643524 CTTGACCTGATGATGGTTGCAGG + Intronic
981723251 4:147822558-147822580 CGTGCCAGGTTGAAGATGGCGGG + Intronic
982237454 4:153264879-153264901 AGTGACCTGTTGAAGGCATCTGG - Intronic
982802630 4:159723179-159723201 GATGACATGTTGATGGTGGCAGG - Intergenic
983856227 4:172648787-172648809 GGTGACATCTTGAAGCTGGCAGG - Intronic
984801058 4:183717633-183717655 CATGGCCGGCTGAAGGTGGCTGG + Intergenic
988143855 5:27278318-27278340 CTTGGCTTCTTGAAGGTGGCAGG + Intergenic
988523593 5:31967407-31967429 TGTGACCTGTTGGATTTGGCTGG + Intronic
989643415 5:43604175-43604197 CGTGACTTGTTTATGGTTGCCGG + Intronic
990408472 5:55516133-55516155 GGTGACATGTTGAAGGTGTAGGG - Intronic
991543231 5:67752443-67752465 CCTGCCCTGGTGAAGGTGGCAGG - Intergenic
993743055 5:91563387-91563409 CCTGCTCTGTTGGAGGTGGCAGG - Intergenic
995844579 5:116480143-116480165 CATGGCCTGTTGAAGATGGAGGG + Exonic
997256606 5:132433626-132433648 GGTCACCTCTTGAAGGTGGTAGG - Intronic
1001111568 5:168900952-168900974 CGTGAGGGGTAGAAGGTGGCTGG + Intronic
1003565549 6:7219419-7219441 CTTGACCTGTTGGAGCTGGTTGG + Intronic
1004630727 6:17418605-17418627 TGTGAGCTGCTGGAGGTGGCTGG + Intronic
1007112177 6:39319301-39319323 AGTGACCTGTGCAAGGTGACTGG + Intronic
1007360297 6:41350737-41350759 CGTGACCTGTTGAAGGTGGCAGG - Exonic
1007634735 6:43292510-43292532 CATGACCTGAAGGAGGTGGCTGG + Intergenic
1007957228 6:45929138-45929160 CGTGGCCTGTTGAATGGGGCAGG - Intronic
1011303671 6:85903184-85903206 CGGGGCCTGTTGGGGGTGGCGGG - Intergenic
1011817776 6:91213206-91213228 CCTGCTCTGCTGAAGGTGGCAGG + Intergenic
1012234160 6:96792914-96792936 CGTGATCTGAGGAAAGTGGCTGG + Intergenic
1014175260 6:118325281-118325303 TGGGACCTGTTGAAGGAGTCAGG - Intergenic
1014532085 6:122570316-122570338 CCAGCCTTGTTGAAGGTGGCTGG - Intronic
1014658136 6:124132711-124132733 CCTGCCCTGGTGGAGGTGGCTGG - Intronic
1017132355 6:151118490-151118512 AGTGGCATGTTGAAGGTGTCAGG + Intergenic
1019532466 7:1510737-1510759 CGTGACCTGATCAGTGTGGCAGG + Intergenic
1024450304 7:49532427-49532449 TGTGGCCTGTTGTAGGTGGCAGG - Intergenic
1024857064 7:53794615-53794637 GATGACATGTTGATGGTGGCAGG - Intergenic
1026304933 7:69132485-69132507 AATGACCTGTTGGAGGTAGCAGG - Intergenic
1028457131 7:91050573-91050595 TGTGACCTGTTGTAGTTGCCTGG - Intronic
1029144664 7:98437210-98437232 CATGACCTGCTGAAGGTGACAGG + Intergenic
1030981132 7:116186419-116186441 GATGACATGTTGATGGTGGCAGG - Intergenic
1031017174 7:116587552-116587574 CGGGGCCTGTTGAGGGTGGGGGG + Intergenic
1032111073 7:129076060-129076082 GGTGACCATTTGGAGGTGGCAGG + Intergenic
1038912501 8:31982100-31982122 GGTGAACTGGTAAAGGTGGCAGG + Intronic
1042728966 8:71910212-71910234 CCTGATCTGGTAAAGGTGGCAGG + Intronic
1053628411 9:39902393-39902415 CGGGACCTGTTGGGGGTGGAGGG - Intergenic
1053777648 9:41563934-41563956 CGGGACCTGTTGGGGGTGGAGGG + Intergenic
1054215476 9:62348308-62348330 CGGGACCTGTTGGGGGTGGAGGG + Intergenic
1054672005 9:67807039-67807061 CGGGACCTGTTGGGGGTGGAGGG - Intergenic
1059076376 9:111197623-111197645 ACTGACCTGTAGGAGGTGGCTGG - Intergenic
1059328577 9:113520186-113520208 CGTGGCCTGTGGAAGGCGACAGG + Intronic
1060780318 9:126407410-126407432 CGTGTCCTATTGAACGTGACAGG - Intronic
1192491469 X:71579740-71579762 TGGGAGCAGTTGAAGGTGGCTGG + Intronic
1192929630 X:75792166-75792188 CCTGTCCTGGTGGAGGTGGCAGG - Intergenic
1193714966 X:84927155-84927177 AGTCACCTGTAGAAGGTGTCTGG + Intergenic
1194439014 X:93906315-93906337 CCTGATCTGGTGGAGGTGGCAGG + Intergenic
1197445407 X:126547405-126547427 AGTGACATGTTGAATGTAGCTGG + Intergenic
1198568645 X:137932322-137932344 CATGAACTGTTCTAGGTGGCAGG - Intergenic
1199586902 X:149424141-149424163 CCTGTTCTGGTGAAGGTGGCAGG - Intergenic