ID: 1007364993

View in Genome Browser
Species Human (GRCh38)
Location 6:41385032-41385054
Sequence CTGTGTGTATGTGGGGAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007364993_1007365005 10 Left 1007364993 6:41385032-41385054 CCCCCTTCCCCACATACACACAG No data
Right 1007365005 6:41385065-41385087 GTCAACATCCTGCACTGGAGTGG No data
1007364993_1007365004 5 Left 1007364993 6:41385032-41385054 CCCCCTTCCCCACATACACACAG No data
Right 1007365004 6:41385060-41385082 CCACTGTCAACATCCTGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007364993 Original CRISPR CTGTGTGTATGTGGGGAAGG GGG (reversed) Intergenic
No off target data available for this crispr