ID: 1007367714

View in Genome Browser
Species Human (GRCh38)
Location 6:41406635-41406657
Sequence AAGCAGAAGCAGAAGGAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007367710_1007367714 13 Left 1007367710 6:41406599-41406621 CCTGGAATGTATTTTATTTTTCT No data
Right 1007367714 6:41406635-41406657 AAGCAGAAGCAGAAGGAGGTTGG No data
1007367709_1007367714 20 Left 1007367709 6:41406592-41406614 CCTGGTTCCTGGAATGTATTTTA No data
Right 1007367714 6:41406635-41406657 AAGCAGAAGCAGAAGGAGGTTGG No data
1007367708_1007367714 24 Left 1007367708 6:41406588-41406610 CCGTCCTGGTTCCTGGAATGTAT No data
Right 1007367714 6:41406635-41406657 AAGCAGAAGCAGAAGGAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007367714 Original CRISPR AAGCAGAAGCAGAAGGAGGT TGG Intergenic
No off target data available for this crispr