ID: 1007367777

View in Genome Browser
Species Human (GRCh38)
Location 6:41406909-41406931
Sequence CCTCGCCCGCCCCCAAGCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007367777_1007367782 -5 Left 1007367777 6:41406909-41406931 CCTAGGCTTGGGGGCGGGCGAGG No data
Right 1007367782 6:41406927-41406949 CGAGGAGCGGCGCTGGGACGTGG No data
1007367777_1007367784 23 Left 1007367777 6:41406909-41406931 CCTAGGCTTGGGGGCGGGCGAGG No data
Right 1007367784 6:41406955-41406977 CAACCGAGCGCACCAGAGCGCGG No data
1007367777_1007367786 28 Left 1007367777 6:41406909-41406931 CCTAGGCTTGGGGGCGGGCGAGG No data
Right 1007367786 6:41406960-41406982 GAGCGCACCAGAGCGCGGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007367777 Original CRISPR CCTCGCCCGCCCCCAAGCCT AGG (reversed) Intergenic
No off target data available for this crispr