ID: 1007367980

View in Genome Browser
Species Human (GRCh38)
Location 6:41407963-41407985
Sequence CTCTGAGCCTGGCAGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007367980_1007367988 15 Left 1007367980 6:41407963-41407985 CCTCCTTCCTGCCAGGCTCAGAG No data
Right 1007367988 6:41408001-41408023 GGCTAGTCTACCAGCTCCCCAGG No data
1007367980_1007367989 16 Left 1007367980 6:41407963-41407985 CCTCCTTCCTGCCAGGCTCAGAG No data
Right 1007367989 6:41408002-41408024 GCTAGTCTACCAGCTCCCCAGGG No data
1007367980_1007367990 17 Left 1007367980 6:41407963-41407985 CCTCCTTCCTGCCAGGCTCAGAG No data
Right 1007367990 6:41408003-41408025 CTAGTCTACCAGCTCCCCAGGGG No data
1007367980_1007367985 -6 Left 1007367980 6:41407963-41407985 CCTCCTTCCTGCCAGGCTCAGAG No data
Right 1007367985 6:41407980-41408002 TCAGAGGCCACCAGCACAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007367980 Original CRISPR CTCTGAGCCTGGCAGGAAGG AGG (reversed) Intergenic
No off target data available for this crispr