ID: 1007367984

View in Genome Browser
Species Human (GRCh38)
Location 6:41407974-41407996
Sequence GTGCTGGTGGCCTCTGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007367984_1007367988 4 Left 1007367984 6:41407974-41407996 CCAGGCTCAGAGGCCACCAGCAC No data
Right 1007367988 6:41408001-41408023 GGCTAGTCTACCAGCTCCCCAGG No data
1007367984_1007367989 5 Left 1007367984 6:41407974-41407996 CCAGGCTCAGAGGCCACCAGCAC No data
Right 1007367989 6:41408002-41408024 GCTAGTCTACCAGCTCCCCAGGG No data
1007367984_1007367990 6 Left 1007367984 6:41407974-41407996 CCAGGCTCAGAGGCCACCAGCAC No data
Right 1007367990 6:41408003-41408025 CTAGTCTACCAGCTCCCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007367984 Original CRISPR GTGCTGGTGGCCTCTGAGCC TGG (reversed) Intergenic
No off target data available for this crispr