ID: 1007367987

View in Genome Browser
Species Human (GRCh38)
Location 6:41407990-41408012
Sequence GGTAGACTAGCCATCTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007367987_1007367990 -10 Left 1007367987 6:41407990-41408012 CCAGCACAGATGGCTAGTCTACC No data
Right 1007367990 6:41408003-41408025 CTAGTCTACCAGCTCCCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007367987 Original CRISPR GGTAGACTAGCCATCTGTGC TGG (reversed) Intergenic
No off target data available for this crispr