ID: 1007367988

View in Genome Browser
Species Human (GRCh38)
Location 6:41408001-41408023
Sequence GGCTAGTCTACCAGCTCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007367983_1007367988 8 Left 1007367983 6:41407970-41407992 CCTGCCAGGCTCAGAGGCCACCA No data
Right 1007367988 6:41408001-41408023 GGCTAGTCTACCAGCTCCCCAGG No data
1007367980_1007367988 15 Left 1007367980 6:41407963-41407985 CCTCCTTCCTGCCAGGCTCAGAG No data
Right 1007367988 6:41408001-41408023 GGCTAGTCTACCAGCTCCCCAGG No data
1007367979_1007367988 21 Left 1007367979 6:41407957-41407979 CCGTCTCCTCCTTCCTGCCAGGC No data
Right 1007367988 6:41408001-41408023 GGCTAGTCTACCAGCTCCCCAGG No data
1007367986_1007367988 -9 Left 1007367986 6:41407987-41408009 CCACCAGCACAGATGGCTAGTCT No data
Right 1007367988 6:41408001-41408023 GGCTAGTCTACCAGCTCCCCAGG No data
1007367984_1007367988 4 Left 1007367984 6:41407974-41407996 CCAGGCTCAGAGGCCACCAGCAC No data
Right 1007367988 6:41408001-41408023 GGCTAGTCTACCAGCTCCCCAGG No data
1007367982_1007367988 12 Left 1007367982 6:41407966-41407988 CCTTCCTGCCAGGCTCAGAGGCC No data
Right 1007367988 6:41408001-41408023 GGCTAGTCTACCAGCTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007367988 Original CRISPR GGCTAGTCTACCAGCTCCCC AGG Intergenic
No off target data available for this crispr