ID: 1007370109

View in Genome Browser
Species Human (GRCh38)
Location 6:41421229-41421251
Sequence ATGTGTTTGGGGAAGGCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007370098_1007370109 13 Left 1007370098 6:41421193-41421215 CCCTCCACTTGTCTCCTGGTAAA No data
Right 1007370109 6:41421229-41421251 ATGTGTTTGGGGAAGGCAGGTGG No data
1007370095_1007370109 25 Left 1007370095 6:41421181-41421203 CCCAGAAAGGTGCCCTCCACTTG No data
Right 1007370109 6:41421229-41421251 ATGTGTTTGGGGAAGGCAGGTGG No data
1007370099_1007370109 12 Left 1007370099 6:41421194-41421216 CCTCCACTTGTCTCCTGGTAAAG No data
Right 1007370109 6:41421229-41421251 ATGTGTTTGGGGAAGGCAGGTGG No data
1007370096_1007370109 24 Left 1007370096 6:41421182-41421204 CCAGAAAGGTGCCCTCCACTTGT No data
Right 1007370109 6:41421229-41421251 ATGTGTTTGGGGAAGGCAGGTGG No data
1007370103_1007370109 -1 Left 1007370103 6:41421207-41421229 CCTGGTAAAGGTGCAACATGGTA No data
Right 1007370109 6:41421229-41421251 ATGTGTTTGGGGAAGGCAGGTGG No data
1007370101_1007370109 9 Left 1007370101 6:41421197-41421219 CCACTTGTCTCCTGGTAAAGGTG No data
Right 1007370109 6:41421229-41421251 ATGTGTTTGGGGAAGGCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007370109 Original CRISPR ATGTGTTTGGGGAAGGCAGG TGG Intergenic
No off target data available for this crispr