ID: 1007371084

View in Genome Browser
Species Human (GRCh38)
Location 6:41427542-41427564
Sequence CTGGGAGAGGGGAAGCTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007371068_1007371084 6 Left 1007371068 6:41427513-41427535 CCCAGGCCTAGGGGTCGGTGTCG No data
Right 1007371084 6:41427542-41427564 CTGGGAGAGGGGAAGCTGGGGGG No data
1007371064_1007371084 12 Left 1007371064 6:41427507-41427529 CCTACCCCCAGGCCTAGGGGTCG No data
Right 1007371084 6:41427542-41427564 CTGGGAGAGGGGAAGCTGGGGGG No data
1007371066_1007371084 8 Left 1007371066 6:41427511-41427533 CCCCCAGGCCTAGGGGTCGGTGT No data
Right 1007371084 6:41427542-41427564 CTGGGAGAGGGGAAGCTGGGGGG No data
1007371067_1007371084 7 Left 1007371067 6:41427512-41427534 CCCCAGGCCTAGGGGTCGGTGTC No data
Right 1007371084 6:41427542-41427564 CTGGGAGAGGGGAAGCTGGGGGG No data
1007371074_1007371084 0 Left 1007371074 6:41427519-41427541 CCTAGGGGTCGGTGTCGGGGGCA No data
Right 1007371084 6:41427542-41427564 CTGGGAGAGGGGAAGCTGGGGGG No data
1007371069_1007371084 5 Left 1007371069 6:41427514-41427536 CCAGGCCTAGGGGTCGGTGTCGG No data
Right 1007371084 6:41427542-41427564 CTGGGAGAGGGGAAGCTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007371084 Original CRISPR CTGGGAGAGGGGAAGCTGGG GGG Intergenic
No off target data available for this crispr