ID: 1007373963

View in Genome Browser
Species Human (GRCh38)
Location 6:41443815-41443837
Sequence TGGGAGCAGACAGAGATCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007373958_1007373963 11 Left 1007373958 6:41443781-41443803 CCAGCATGTGGAAAAGTCATTTT No data
Right 1007373963 6:41443815-41443837 TGGGAGCAGACAGAGATCAGGGG No data
1007373957_1007373963 12 Left 1007373957 6:41443780-41443802 CCCAGCATGTGGAAAAGTCATTT No data
Right 1007373963 6:41443815-41443837 TGGGAGCAGACAGAGATCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007373963 Original CRISPR TGGGAGCAGACAGAGATCAG GGG Intergenic
No off target data available for this crispr