ID: 1007374624

View in Genome Browser
Species Human (GRCh38)
Location 6:41447976-41447998
Sequence CTGGATTGGGTGGGATGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007374624_1007374635 18 Left 1007374624 6:41447976-41447998 CCTGGACATCCCACCCAATCCAG No data
Right 1007374635 6:41448017-41448039 CCAGCTACTACCTGGGAACCAGG No data
1007374624_1007374632 11 Left 1007374624 6:41447976-41447998 CCTGGACATCCCACCCAATCCAG No data
Right 1007374632 6:41448010-41448032 CTCCATTCCAGCTACTACCTGGG No data
1007374624_1007374631 10 Left 1007374624 6:41447976-41447998 CCTGGACATCCCACCCAATCCAG No data
Right 1007374631 6:41448009-41448031 ACTCCATTCCAGCTACTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007374624 Original CRISPR CTGGATTGGGTGGGATGTCC AGG (reversed) Intergenic
No off target data available for this crispr