ID: 1007374627

View in Genome Browser
Species Human (GRCh38)
Location 6:41447989-41448011
Sequence AGTTGCTTGAAGGCTGGATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007374627_1007374635 5 Left 1007374627 6:41447989-41448011 CCCAATCCAGCCTTCAAGCAACT No data
Right 1007374635 6:41448017-41448039 CCAGCTACTACCTGGGAACCAGG No data
1007374627_1007374631 -3 Left 1007374627 6:41447989-41448011 CCCAATCCAGCCTTCAAGCAACT No data
Right 1007374631 6:41448009-41448031 ACTCCATTCCAGCTACTACCTGG No data
1007374627_1007374632 -2 Left 1007374627 6:41447989-41448011 CCCAATCCAGCCTTCAAGCAACT No data
Right 1007374632 6:41448010-41448032 CTCCATTCCAGCTACTACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007374627 Original CRISPR AGTTGCTTGAAGGCTGGATT GGG (reversed) Intergenic
No off target data available for this crispr