ID: 1007374630

View in Genome Browser
Species Human (GRCh38)
Location 6:41447999-41448021
Sequence GCTGGAATGGAGTTGCTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007374630_1007374641 27 Left 1007374630 6:41447999-41448021 CCTTCAAGCAACTCCATTCCAGC No data
Right 1007374641 6:41448049-41448071 CCAAGCAAGAACTGCCTAGCTGG No data
1007374630_1007374635 -5 Left 1007374630 6:41447999-41448021 CCTTCAAGCAACTCCATTCCAGC No data
Right 1007374635 6:41448017-41448039 CCAGCTACTACCTGGGAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007374630 Original CRISPR GCTGGAATGGAGTTGCTTGA AGG (reversed) Intergenic
No off target data available for this crispr