ID: 1007374635

View in Genome Browser
Species Human (GRCh38)
Location 6:41448017-41448039
Sequence CCAGCTACTACCTGGGAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007374629_1007374635 -1 Left 1007374629 6:41447995-41448017 CCAGCCTTCAAGCAACTCCATTC No data
Right 1007374635 6:41448017-41448039 CCAGCTACTACCTGGGAACCAGG No data
1007374624_1007374635 18 Left 1007374624 6:41447976-41447998 CCTGGACATCCCACCCAATCCAG No data
Right 1007374635 6:41448017-41448039 CCAGCTACTACCTGGGAACCAGG No data
1007374626_1007374635 8 Left 1007374626 6:41447986-41448008 CCACCCAATCCAGCCTTCAAGCA No data
Right 1007374635 6:41448017-41448039 CCAGCTACTACCTGGGAACCAGG No data
1007374627_1007374635 5 Left 1007374627 6:41447989-41448011 CCCAATCCAGCCTTCAAGCAACT No data
Right 1007374635 6:41448017-41448039 CCAGCTACTACCTGGGAACCAGG No data
1007374630_1007374635 -5 Left 1007374630 6:41447999-41448021 CCTTCAAGCAACTCCATTCCAGC No data
Right 1007374635 6:41448017-41448039 CCAGCTACTACCTGGGAACCAGG No data
1007374625_1007374635 9 Left 1007374625 6:41447985-41448007 CCCACCCAATCCAGCCTTCAAGC No data
Right 1007374635 6:41448017-41448039 CCAGCTACTACCTGGGAACCAGG No data
1007374628_1007374635 4 Left 1007374628 6:41447990-41448012 CCAATCCAGCCTTCAAGCAACTC No data
Right 1007374635 6:41448017-41448039 CCAGCTACTACCTGGGAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007374635 Original CRISPR CCAGCTACTACCTGGGAACC AGG Intergenic
No off target data available for this crispr