ID: 1007375968

View in Genome Browser
Species Human (GRCh38)
Location 6:41456909-41456931
Sequence CTGGGTAAACAGCTGCTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007375962_1007375968 15 Left 1007375962 6:41456871-41456893 CCACCTGTTGCTATGGAGAAGCC No data
Right 1007375968 6:41456909-41456931 CTGGGTAAACAGCTGCTGCTGGG No data
1007375966_1007375968 -6 Left 1007375966 6:41456892-41456914 CCTCTTTATCGCAAACACTGGGT No data
Right 1007375968 6:41456909-41456931 CTGGGTAAACAGCTGCTGCTGGG No data
1007375963_1007375968 12 Left 1007375963 6:41456874-41456896 CCTGTTGCTATGGAGAAGCCTCT No data
Right 1007375968 6:41456909-41456931 CTGGGTAAACAGCTGCTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007375968 Original CRISPR CTGGGTAAACAGCTGCTGCT GGG Intergenic
No off target data available for this crispr