ID: 1007375993

View in Genome Browser
Species Human (GRCh38)
Location 6:41457051-41457073
Sequence TGCCTGACCCTCTGGGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007375993_1007376008 28 Left 1007375993 6:41457051-41457073 CCAGCTCCCCAGAGGGTCAGGCA No data
Right 1007376008 6:41457102-41457124 CAGCATCTTCCAGTTAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007375993 Original CRISPR TGCCTGACCCTCTGGGGAGC TGG (reversed) Intergenic
No off target data available for this crispr