ID: 1007380411

View in Genome Browser
Species Human (GRCh38)
Location 6:41486828-41486850
Sequence GCAAGTGCATGTGTGTGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007380406_1007380411 23 Left 1007380406 6:41486782-41486804 CCAGGAGGTGGATGGGGTGTGCG No data
Right 1007380411 6:41486828-41486850 GCAAGTGCATGTGTGTGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007380411 Original CRISPR GCAAGTGCATGTGTGTGCTG GGG Intergenic
No off target data available for this crispr