ID: 1007380710

View in Genome Browser
Species Human (GRCh38)
Location 6:41488527-41488549
Sequence CACACTTCAGGGGCCTCCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007380688_1007380710 28 Left 1007380688 6:41488476-41488498 CCGCCTAAAGTGGGCTGCTCACG No data
Right 1007380710 6:41488527-41488549 CACACTTCAGGGGCCTCCAAGGG No data
1007380700_1007380710 -9 Left 1007380700 6:41488513-41488535 CCCAGCCCCTCCTACACACTTCA No data
Right 1007380710 6:41488527-41488549 CACACTTCAGGGGCCTCCAAGGG No data
1007380690_1007380710 25 Left 1007380690 6:41488479-41488501 CCTAAAGTGGGCTGCTCACGGTG No data
Right 1007380710 6:41488527-41488549 CACACTTCAGGGGCCTCCAAGGG No data
1007380696_1007380710 -3 Left 1007380696 6:41488507-41488529 CCCGCCCCCAGCCCCTCCTACAC No data
Right 1007380710 6:41488527-41488549 CACACTTCAGGGGCCTCCAAGGG No data
1007380699_1007380710 -8 Left 1007380699 6:41488512-41488534 CCCCAGCCCCTCCTACACACTTC No data
Right 1007380710 6:41488527-41488549 CACACTTCAGGGGCCTCCAAGGG No data
1007380698_1007380710 -7 Left 1007380698 6:41488511-41488533 CCCCCAGCCCCTCCTACACACTT No data
Right 1007380710 6:41488527-41488549 CACACTTCAGGGGCCTCCAAGGG No data
1007380701_1007380710 -10 Left 1007380701 6:41488514-41488536 CCAGCCCCTCCTACACACTTCAG No data
Right 1007380710 6:41488527-41488549 CACACTTCAGGGGCCTCCAAGGG No data
1007380697_1007380710 -4 Left 1007380697 6:41488508-41488530 CCGCCCCCAGCCCCTCCTACACA No data
Right 1007380710 6:41488527-41488549 CACACTTCAGGGGCCTCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007380710 Original CRISPR CACACTTCAGGGGCCTCCAA GGG Intergenic