ID: 1007385584

View in Genome Browser
Species Human (GRCh38)
Location 6:41518216-41518238
Sequence CTGCATGTAAACATGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007385579_1007385584 -1 Left 1007385579 6:41518194-41518216 CCATCTGAAGGGGTGTGGCCCGC No data
Right 1007385584 6:41518216-41518238 CTGCATGTAAACATGGAGGAAGG No data
1007385574_1007385584 22 Left 1007385574 6:41518171-41518193 CCGGAAGGGGGTGTCAGTCTGTG No data
Right 1007385584 6:41518216-41518238 CTGCATGTAAACATGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007385584 Original CRISPR CTGCATGTAAACATGGAGGA AGG Intergenic
No off target data available for this crispr