ID: 1007386284

View in Genome Browser
Species Human (GRCh38)
Location 6:41522381-41522403
Sequence CCTTCCAGCTTTGAGATTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007386278_1007386284 -4 Left 1007386278 6:41522362-41522384 CCCGTTGGCTTCTGGGATCCCTT No data
Right 1007386284 6:41522381-41522403 CCTTCCAGCTTTGAGATTTGGGG No data
1007386279_1007386284 -5 Left 1007386279 6:41522363-41522385 CCGTTGGCTTCTGGGATCCCTTC No data
Right 1007386284 6:41522381-41522403 CCTTCCAGCTTTGAGATTTGGGG No data
1007386274_1007386284 16 Left 1007386274 6:41522342-41522364 CCTTCTCTGCGAAGTTTGGACCC No data
Right 1007386284 6:41522381-41522403 CCTTCCAGCTTTGAGATTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007386284 Original CRISPR CCTTCCAGCTTTGAGATTTG GGG Intergenic
No off target data available for this crispr