ID: 1007387338

View in Genome Browser
Species Human (GRCh38)
Location 6:41528697-41528719
Sequence ATCACAGCTCAGAGTGGGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007387332_1007387338 12 Left 1007387332 6:41528662-41528684 CCAAGTGGTCTGCAAGTTTCTGA No data
Right 1007387338 6:41528697-41528719 ATCACAGCTCAGAGTGGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007387338 Original CRISPR ATCACAGCTCAGAGTGGGTT TGG Intergenic
No off target data available for this crispr