ID: 1007396834

View in Genome Browser
Species Human (GRCh38)
Location 6:41582835-41582857
Sequence GAATGTGGAGGTGGGACGTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007396834_1007396843 10 Left 1007396834 6:41582835-41582857 CCGGACGTCCCACCTCCACATTC No data
Right 1007396843 6:41582868-41582890 CCTTCCCAAGACCTGCCCTGCGG 0: 1
1: 0
2: 0
3: 35
4: 373
1007396834_1007396844 13 Left 1007396834 6:41582835-41582857 CCGGACGTCCCACCTCCACATTC No data
Right 1007396844 6:41582871-41582893 TCCCAAGACCTGCCCTGCGGTGG No data
1007396834_1007396848 15 Left 1007396834 6:41582835-41582857 CCGGACGTCCCACCTCCACATTC No data
Right 1007396848 6:41582873-41582895 CCAAGACCTGCCCTGCGGTGGGG 0: 1
1: 1
2: 16
3: 113
4: 551
1007396834_1007396853 28 Left 1007396834 6:41582835-41582857 CCGGACGTCCCACCTCCACATTC No data
Right 1007396853 6:41582886-41582908 TGCGGTGGGGCAGGCAGCATAGG 0: 1
1: 0
2: 0
3: 30
4: 283
1007396834_1007396849 19 Left 1007396834 6:41582835-41582857 CCGGACGTCCCACCTCCACATTC No data
Right 1007396849 6:41582877-41582899 GACCTGCCCTGCGGTGGGGCAGG 0: 1
1: 0
2: 4
3: 36
4: 301
1007396834_1007396846 14 Left 1007396834 6:41582835-41582857 CCGGACGTCCCACCTCCACATTC No data
Right 1007396846 6:41582872-41582894 CCCAAGACCTGCCCTGCGGTGGG 0: 1
1: 0
2: 0
3: 26
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007396834 Original CRISPR GAATGTGGAGGTGGGACGTC CGG (reversed) Intronic