ID: 1007396836

View in Genome Browser
Species Human (GRCh38)
Location 6:41582844-41582866
Sequence TTAGGGAGAGAATGTGGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 573
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 530}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007396836_1007396849 10 Left 1007396836 6:41582844-41582866 CCACCTCCACATTCTCTCCCTAA 0: 1
1: 0
2: 2
3: 40
4: 530
Right 1007396849 6:41582877-41582899 GACCTGCCCTGCGGTGGGGCAGG 0: 1
1: 0
2: 4
3: 36
4: 301
1007396836_1007396846 5 Left 1007396836 6:41582844-41582866 CCACCTCCACATTCTCTCCCTAA 0: 1
1: 0
2: 2
3: 40
4: 530
Right 1007396846 6:41582872-41582894 CCCAAGACCTGCCCTGCGGTGGG 0: 1
1: 0
2: 0
3: 26
4: 178
1007396836_1007396848 6 Left 1007396836 6:41582844-41582866 CCACCTCCACATTCTCTCCCTAA 0: 1
1: 0
2: 2
3: 40
4: 530
Right 1007396848 6:41582873-41582895 CCAAGACCTGCCCTGCGGTGGGG 0: 1
1: 1
2: 16
3: 113
4: 551
1007396836_1007396853 19 Left 1007396836 6:41582844-41582866 CCACCTCCACATTCTCTCCCTAA 0: 1
1: 0
2: 2
3: 40
4: 530
Right 1007396853 6:41582886-41582908 TGCGGTGGGGCAGGCAGCATAGG 0: 1
1: 0
2: 0
3: 30
4: 283
1007396836_1007396844 4 Left 1007396836 6:41582844-41582866 CCACCTCCACATTCTCTCCCTAA 0: 1
1: 0
2: 2
3: 40
4: 530
Right 1007396844 6:41582871-41582893 TCCCAAGACCTGCCCTGCGGTGG No data
1007396836_1007396843 1 Left 1007396836 6:41582844-41582866 CCACCTCCACATTCTCTCCCTAA 0: 1
1: 0
2: 2
3: 40
4: 530
Right 1007396843 6:41582868-41582890 CCTTCCCAAGACCTGCCCTGCGG 0: 1
1: 0
2: 0
3: 35
4: 373

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007396836 Original CRISPR TTAGGGAGAGAATGTGGAGG TGG (reversed) Intronic