ID: 1007396839

View in Genome Browser
Species Human (GRCh38)
Location 6:41582861-41582883
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 214}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007396839_1007396849 -7 Left 1007396839 6:41582861-41582883 CCCTAACCCTTCCCAAGACCTGC 0: 1
1: 0
2: 0
3: 19
4: 214
Right 1007396849 6:41582877-41582899 GACCTGCCCTGCGGTGGGGCAGG 0: 1
1: 0
2: 4
3: 36
4: 301
1007396839_1007396854 17 Left 1007396839 6:41582861-41582883 CCCTAACCCTTCCCAAGACCTGC 0: 1
1: 0
2: 0
3: 19
4: 214
Right 1007396854 6:41582901-41582923 AGCATAGGATGTGAAAACCCTGG No data
1007396839_1007396853 2 Left 1007396839 6:41582861-41582883 CCCTAACCCTTCCCAAGACCTGC 0: 1
1: 0
2: 0
3: 19
4: 214
Right 1007396853 6:41582886-41582908 TGCGGTGGGGCAGGCAGCATAGG 0: 1
1: 0
2: 0
3: 30
4: 283
1007396839_1007396856 26 Left 1007396839 6:41582861-41582883 CCCTAACCCTTCCCAAGACCTGC 0: 1
1: 0
2: 0
3: 19
4: 214
Right 1007396856 6:41582910-41582932 TGTGAAAACCCTGGGAGCTATGG No data
1007396839_1007396855 18 Left 1007396839 6:41582861-41582883 CCCTAACCCTTCCCAAGACCTGC 0: 1
1: 0
2: 0
3: 19
4: 214
Right 1007396855 6:41582902-41582924 GCATAGGATGTGAAAACCCTGGG 0: 1
1: 0
2: 0
3: 21
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007396839 Original CRISPR GCAGGTCTTGGGAAGGGTTA GGG (reversed) Intronic