ID: 1007396840

View in Genome Browser
Species Human (GRCh38)
Location 6:41582862-41582884
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007396840_1007396849 -8 Left 1007396840 6:41582862-41582884 CCTAACCCTTCCCAAGACCTGCC No data
Right 1007396849 6:41582877-41582899 GACCTGCCCTGCGGTGGGGCAGG 0: 1
1: 0
2: 4
3: 36
4: 301
1007396840_1007396855 17 Left 1007396840 6:41582862-41582884 CCTAACCCTTCCCAAGACCTGCC No data
Right 1007396855 6:41582902-41582924 GCATAGGATGTGAAAACCCTGGG 0: 1
1: 0
2: 0
3: 21
4: 103
1007396840_1007396854 16 Left 1007396840 6:41582862-41582884 CCTAACCCTTCCCAAGACCTGCC No data
Right 1007396854 6:41582901-41582923 AGCATAGGATGTGAAAACCCTGG No data
1007396840_1007396853 1 Left 1007396840 6:41582862-41582884 CCTAACCCTTCCCAAGACCTGCC No data
Right 1007396853 6:41582886-41582908 TGCGGTGGGGCAGGCAGCATAGG 0: 1
1: 0
2: 0
3: 30
4: 283
1007396840_1007396856 25 Left 1007396840 6:41582862-41582884 CCTAACCCTTCCCAAGACCTGCC No data
Right 1007396856 6:41582910-41582932 TGTGAAAACCCTGGGAGCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007396840 Original CRISPR GGCAGGTCTTGGGAAGGGTT AGG (reversed) Intronic