ID: 1007396842

View in Genome Browser
Species Human (GRCh38)
Location 6:41582868-41582890
Sequence CCGCAGGGCAGGTCTTGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 211}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007396842_1007396854 10 Left 1007396842 6:41582868-41582890 CCTTCCCAAGACCTGCCCTGCGG 0: 1
1: 0
2: 1
3: 13
4: 211
Right 1007396854 6:41582901-41582923 AGCATAGGATGTGAAAACCCTGG No data
1007396842_1007396856 19 Left 1007396842 6:41582868-41582890 CCTTCCCAAGACCTGCCCTGCGG 0: 1
1: 0
2: 1
3: 13
4: 211
Right 1007396856 6:41582910-41582932 TGTGAAAACCCTGGGAGCTATGG No data
1007396842_1007396855 11 Left 1007396842 6:41582868-41582890 CCTTCCCAAGACCTGCCCTGCGG 0: 1
1: 0
2: 1
3: 13
4: 211
Right 1007396855 6:41582902-41582924 GCATAGGATGTGAAAACCCTGGG 0: 1
1: 0
2: 0
3: 21
4: 103
1007396842_1007396853 -5 Left 1007396842 6:41582868-41582890 CCTTCCCAAGACCTGCCCTGCGG 0: 1
1: 0
2: 1
3: 13
4: 211
Right 1007396853 6:41582886-41582908 TGCGGTGGGGCAGGCAGCATAGG 0: 1
1: 0
2: 0
3: 30
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007396842 Original CRISPR CCGCAGGGCAGGTCTTGGGA AGG (reversed) Intronic