ID: 1007396851

View in Genome Browser
Species Human (GRCh38)
Location 6:41582883-41582905
Sequence ATGCTGCCTGCCCCACCGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 179}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007396851_1007396856 4 Left 1007396851 6:41582883-41582905 CCCTGCGGTGGGGCAGGCAGCAT 0: 1
1: 0
2: 0
3: 16
4: 179
Right 1007396856 6:41582910-41582932 TGTGAAAACCCTGGGAGCTATGG No data
1007396851_1007396855 -4 Left 1007396851 6:41582883-41582905 CCCTGCGGTGGGGCAGGCAGCAT 0: 1
1: 0
2: 0
3: 16
4: 179
Right 1007396855 6:41582902-41582924 GCATAGGATGTGAAAACCCTGGG 0: 1
1: 0
2: 0
3: 21
4: 103
1007396851_1007396854 -5 Left 1007396851 6:41582883-41582905 CCCTGCGGTGGGGCAGGCAGCAT 0: 1
1: 0
2: 0
3: 16
4: 179
Right 1007396854 6:41582901-41582923 AGCATAGGATGTGAAAACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007396851 Original CRISPR ATGCTGCCTGCCCCACCGCA GGG (reversed) Intronic