ID: 1007396852

View in Genome Browser
Species Human (GRCh38)
Location 6:41582884-41582906
Sequence TATGCTGCCTGCCCCACCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007396852_1007396856 3 Left 1007396852 6:41582884-41582906 CCTGCGGTGGGGCAGGCAGCATA No data
Right 1007396856 6:41582910-41582932 TGTGAAAACCCTGGGAGCTATGG No data
1007396852_1007396855 -5 Left 1007396852 6:41582884-41582906 CCTGCGGTGGGGCAGGCAGCATA No data
Right 1007396855 6:41582902-41582924 GCATAGGATGTGAAAACCCTGGG 0: 1
1: 0
2: 0
3: 21
4: 103
1007396852_1007396854 -6 Left 1007396852 6:41582884-41582906 CCTGCGGTGGGGCAGGCAGCATA No data
Right 1007396854 6:41582901-41582923 AGCATAGGATGTGAAAACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007396852 Original CRISPR TATGCTGCCTGCCCCACCGC AGG (reversed) Intronic