ID: 1007396853

View in Genome Browser
Species Human (GRCh38)
Location 6:41582886-41582908
Sequence TGCGGTGGGGCAGGCAGCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 283}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007396836_1007396853 19 Left 1007396836 6:41582844-41582866 CCACCTCCACATTCTCTCCCTAA 0: 1
1: 0
2: 2
3: 40
4: 530
Right 1007396853 6:41582886-41582908 TGCGGTGGGGCAGGCAGCATAGG 0: 1
1: 0
2: 0
3: 30
4: 283
1007396835_1007396853 20 Left 1007396835 6:41582843-41582865 CCCACCTCCACATTCTCTCCCTA 0: 1
1: 0
2: 7
3: 48
4: 492
Right 1007396853 6:41582886-41582908 TGCGGTGGGGCAGGCAGCATAGG 0: 1
1: 0
2: 0
3: 30
4: 283
1007396847_1007396853 -10 Left 1007396847 6:41582873-41582895 CCAAGACCTGCCCTGCGGTGGGG 0: 1
1: 0
2: 2
3: 82
4: 589
Right 1007396853 6:41582886-41582908 TGCGGTGGGGCAGGCAGCATAGG 0: 1
1: 0
2: 0
3: 30
4: 283
1007396839_1007396853 2 Left 1007396839 6:41582861-41582883 CCCTAACCCTTCCCAAGACCTGC 0: 1
1: 0
2: 0
3: 19
4: 214
Right 1007396853 6:41582886-41582908 TGCGGTGGGGCAGGCAGCATAGG 0: 1
1: 0
2: 0
3: 30
4: 283
1007396841_1007396853 -4 Left 1007396841 6:41582867-41582889 CCCTTCCCAAGACCTGCCCTGCG No data
Right 1007396853 6:41582886-41582908 TGCGGTGGGGCAGGCAGCATAGG 0: 1
1: 0
2: 0
3: 30
4: 283
1007396845_1007396853 -9 Left 1007396845 6:41582872-41582894 CCCAAGACCTGCCCTGCGGTGGG No data
Right 1007396853 6:41582886-41582908 TGCGGTGGGGCAGGCAGCATAGG 0: 1
1: 0
2: 0
3: 30
4: 283
1007396838_1007396853 13 Left 1007396838 6:41582850-41582872 CCACATTCTCTCCCTAACCCTTC 0: 1
1: 0
2: 1
3: 54
4: 800
Right 1007396853 6:41582886-41582908 TGCGGTGGGGCAGGCAGCATAGG 0: 1
1: 0
2: 0
3: 30
4: 283
1007396834_1007396853 28 Left 1007396834 6:41582835-41582857 CCGGACGTCCCACCTCCACATTC No data
Right 1007396853 6:41582886-41582908 TGCGGTGGGGCAGGCAGCATAGG 0: 1
1: 0
2: 0
3: 30
4: 283
1007396840_1007396853 1 Left 1007396840 6:41582862-41582884 CCTAACCCTTCCCAAGACCTGCC No data
Right 1007396853 6:41582886-41582908 TGCGGTGGGGCAGGCAGCATAGG 0: 1
1: 0
2: 0
3: 30
4: 283
1007396842_1007396853 -5 Left 1007396842 6:41582868-41582890 CCTTCCCAAGACCTGCCCTGCGG 0: 1
1: 0
2: 1
3: 13
4: 211
Right 1007396853 6:41582886-41582908 TGCGGTGGGGCAGGCAGCATAGG 0: 1
1: 0
2: 0
3: 30
4: 283
1007396837_1007396853 16 Left 1007396837 6:41582847-41582869 CCTCCACATTCTCTCCCTAACCC 0: 1
1: 0
2: 5
3: 50
4: 518
Right 1007396853 6:41582886-41582908 TGCGGTGGGGCAGGCAGCATAGG 0: 1
1: 0
2: 0
3: 30
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007396853 Original CRISPR TGCGGTGGGGCAGGCAGCAT AGG Intronic