ID: 1007396854

View in Genome Browser
Species Human (GRCh38)
Location 6:41582901-41582923
Sequence AGCATAGGATGTGAAAACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007396850_1007396854 -1 Left 1007396850 6:41582879-41582901 CCTGCCCTGCGGTGGGGCAGGCA 0: 1
1: 0
2: 4
3: 39
4: 329
Right 1007396854 6:41582901-41582923 AGCATAGGATGTGAAAACCCTGG No data
1007396851_1007396854 -5 Left 1007396851 6:41582883-41582905 CCCTGCGGTGGGGCAGGCAGCAT 0: 1
1: 0
2: 0
3: 16
4: 179
Right 1007396854 6:41582901-41582923 AGCATAGGATGTGAAAACCCTGG No data
1007396840_1007396854 16 Left 1007396840 6:41582862-41582884 CCTAACCCTTCCCAAGACCTGCC No data
Right 1007396854 6:41582901-41582923 AGCATAGGATGTGAAAACCCTGG No data
1007396841_1007396854 11 Left 1007396841 6:41582867-41582889 CCCTTCCCAAGACCTGCCCTGCG No data
Right 1007396854 6:41582901-41582923 AGCATAGGATGTGAAAACCCTGG No data
1007396852_1007396854 -6 Left 1007396852 6:41582884-41582906 CCTGCGGTGGGGCAGGCAGCATA No data
Right 1007396854 6:41582901-41582923 AGCATAGGATGTGAAAACCCTGG No data
1007396842_1007396854 10 Left 1007396842 6:41582868-41582890 CCTTCCCAAGACCTGCCCTGCGG 0: 1
1: 0
2: 1
3: 13
4: 211
Right 1007396854 6:41582901-41582923 AGCATAGGATGTGAAAACCCTGG No data
1007396845_1007396854 6 Left 1007396845 6:41582872-41582894 CCCAAGACCTGCCCTGCGGTGGG No data
Right 1007396854 6:41582901-41582923 AGCATAGGATGTGAAAACCCTGG No data
1007396847_1007396854 5 Left 1007396847 6:41582873-41582895 CCAAGACCTGCCCTGCGGTGGGG 0: 1
1: 0
2: 2
3: 82
4: 589
Right 1007396854 6:41582901-41582923 AGCATAGGATGTGAAAACCCTGG No data
1007396838_1007396854 28 Left 1007396838 6:41582850-41582872 CCACATTCTCTCCCTAACCCTTC 0: 1
1: 0
2: 1
3: 54
4: 800
Right 1007396854 6:41582901-41582923 AGCATAGGATGTGAAAACCCTGG No data
1007396839_1007396854 17 Left 1007396839 6:41582861-41582883 CCCTAACCCTTCCCAAGACCTGC 0: 1
1: 0
2: 0
3: 19
4: 214
Right 1007396854 6:41582901-41582923 AGCATAGGATGTGAAAACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007396854 Original CRISPR AGCATAGGATGTGAAAACCC TGG Intronic