ID: 1007396856

View in Genome Browser
Species Human (GRCh38)
Location 6:41582910-41582932
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007396839_1007396856 26 Left 1007396839 6:41582861-41582883 CCCTAACCCTTCCCAAGACCTGC 0: 1
1: 0
2: 0
3: 19
4: 214
Right 1007396856 6:41582910-41582932 TGTGAAAACCCTGGGAGCTATGG No data
1007396841_1007396856 20 Left 1007396841 6:41582867-41582889 CCCTTCCCAAGACCTGCCCTGCG No data
Right 1007396856 6:41582910-41582932 TGTGAAAACCCTGGGAGCTATGG No data
1007396845_1007396856 15 Left 1007396845 6:41582872-41582894 CCCAAGACCTGCCCTGCGGTGGG No data
Right 1007396856 6:41582910-41582932 TGTGAAAACCCTGGGAGCTATGG No data
1007396847_1007396856 14 Left 1007396847 6:41582873-41582895 CCAAGACCTGCCCTGCGGTGGGG 0: 1
1: 0
2: 2
3: 82
4: 589
Right 1007396856 6:41582910-41582932 TGTGAAAACCCTGGGAGCTATGG No data
1007396842_1007396856 19 Left 1007396842 6:41582868-41582890 CCTTCCCAAGACCTGCCCTGCGG 0: 1
1: 0
2: 1
3: 13
4: 211
Right 1007396856 6:41582910-41582932 TGTGAAAACCCTGGGAGCTATGG No data
1007396840_1007396856 25 Left 1007396840 6:41582862-41582884 CCTAACCCTTCCCAAGACCTGCC No data
Right 1007396856 6:41582910-41582932 TGTGAAAACCCTGGGAGCTATGG No data
1007396850_1007396856 8 Left 1007396850 6:41582879-41582901 CCTGCCCTGCGGTGGGGCAGGCA 0: 1
1: 0
2: 4
3: 39
4: 329
Right 1007396856 6:41582910-41582932 TGTGAAAACCCTGGGAGCTATGG No data
1007396852_1007396856 3 Left 1007396852 6:41582884-41582906 CCTGCGGTGGGGCAGGCAGCATA No data
Right 1007396856 6:41582910-41582932 TGTGAAAACCCTGGGAGCTATGG No data
1007396851_1007396856 4 Left 1007396851 6:41582883-41582905 CCCTGCGGTGGGGCAGGCAGCAT 0: 1
1: 0
2: 0
3: 16
4: 179
Right 1007396856 6:41582910-41582932 TGTGAAAACCCTGGGAGCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type