ID: 1007397882

View in Genome Browser
Species Human (GRCh38)
Location 6:41587649-41587671
Sequence CGGGGTGTACAGATGGTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 93}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007397869_1007397882 16 Left 1007397869 6:41587610-41587632 CCACGGACCGGAGGTTCACTCCC 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1007397882 6:41587649-41587671 CGGGGTGTACAGATGGTGCTTGG 0: 1
1: 0
2: 0
3: 2
4: 93
1007397874_1007397882 -5 Left 1007397874 6:41587631-41587653 CCTCTCCACTCCCTCTCCCGGGG 0: 1
1: 0
2: 5
3: 55
4: 533
Right 1007397882 6:41587649-41587671 CGGGGTGTACAGATGGTGCTTGG 0: 1
1: 0
2: 0
3: 2
4: 93
1007397870_1007397882 9 Left 1007397870 6:41587617-41587639 CCGGAGGTTCACTCCCTCTCCAC 0: 1
1: 0
2: 1
3: 12
4: 228
Right 1007397882 6:41587649-41587671 CGGGGTGTACAGATGGTGCTTGG 0: 1
1: 0
2: 0
3: 2
4: 93
1007397868_1007397882 17 Left 1007397868 6:41587609-41587631 CCCACGGACCGGAGGTTCACTCC 0: 1
1: 0
2: 0
3: 1
4: 25
Right 1007397882 6:41587649-41587671 CGGGGTGTACAGATGGTGCTTGG 0: 1
1: 0
2: 0
3: 2
4: 93
1007397872_1007397882 -4 Left 1007397872 6:41587630-41587652 CCCTCTCCACTCCCTCTCCCGGG 0: 1
1: 2
2: 5
3: 50
4: 686
Right 1007397882 6:41587649-41587671 CGGGGTGTACAGATGGTGCTTGG 0: 1
1: 0
2: 0
3: 2
4: 93
1007397876_1007397882 -10 Left 1007397876 6:41587636-41587658 CCACTCCCTCTCCCGGGGTGTAC 0: 1
1: 0
2: 0
3: 20
4: 218
Right 1007397882 6:41587649-41587671 CGGGGTGTACAGATGGTGCTTGG 0: 1
1: 0
2: 0
3: 2
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007397882 Original CRISPR CGGGGTGTACAGATGGTGCT TGG Intronic
900191199 1:1353035-1353057 TGGGGAGAACAGATGGTGCCTGG + Exonic
900872811 1:5316541-5316563 AGGGGTCTACACAGGGTGCTGGG + Intergenic
901320848 1:8339076-8339098 GGGGGTGTAAAGATGGTGGCTGG + Intronic
905464079 1:38139692-38139714 GGGGGAGTACAGGGGGTGCTGGG - Intergenic
907307522 1:53521629-53521651 TGGGGTGACCAGATGGGGCTCGG - Intronic
915583670 1:156831468-156831490 CCATGTGTCCAGATGGTGCTGGG + Intronic
920185504 1:204156761-204156783 CTGGGAGGACAGATTGTGCTGGG - Exonic
922725461 1:227920964-227920986 CGGGGCGTACAGCTGGAGCAGGG - Exonic
923506677 1:234610730-234610752 CGGCGTGTGCACGTGGTGCTGGG - Intergenic
923767176 1:236902735-236902757 GTGGGTGTAGAGAGGGTGCTAGG - Exonic
924476210 1:244384040-244384062 TGGGGAGAACAGATGGTGTTTGG - Intronic
1067427723 10:46222160-46222182 AGGGGTGTCTAGATGGTGCCAGG - Intergenic
1067583140 10:47458049-47458071 AGGGGTGTCTAGATGGTGCCAGG - Intergenic
1077496390 11:2888609-2888631 TGCGGTGTGCAGAGGGTGCTTGG - Exonic
1078005389 11:7528713-7528735 AGGGGTGTAGAGTGGGTGCTGGG + Intronic
1084389943 11:68868735-68868757 GGGGGTTTTCAGATGCTGCTTGG - Intergenic
1084721609 11:70909376-70909398 TGGGGATTACAGATGTTGCTAGG + Intronic
1091345812 11:134853223-134853245 CAGGGTGTTAAGAGGGTGCTGGG + Intergenic
1095734064 12:45537033-45537055 CTGGGTACACAGATAGTGCTCGG - Intergenic
1102023230 12:109698354-109698376 GGGCGTGTAAAGATGTTGCTTGG + Intergenic
1102653605 12:114461536-114461558 CTTGTTGTAGAGATGGTGCTGGG - Intergenic
1104155365 12:126126147-126126169 GTGGGTGCACAGATGATGCTGGG + Intergenic
1107922274 13:45221469-45221491 TGGGGGGTACAGATGGTTTTTGG - Intronic
1110359929 13:74613087-74613109 CTGGGTCTACAGTTGGTGCACGG + Intergenic
1113800570 13:113084344-113084366 CTGGGGGTACAGAAGGTTCTGGG - Intronic
1120471686 14:84933623-84933645 TCGGGGGTACAGATGGTGCTTGG + Intergenic
1123630812 15:22258383-22258405 CGGCGTGTACCGCTGGTTCTCGG + Intergenic
1124400699 15:29345359-29345381 CGGGGAGCAGAGATGGGGCTGGG + Intronic
1128772336 15:70291755-70291777 CTAGGTGTGCAGAAGGTGCTTGG - Intergenic
1129231167 15:74197863-74197885 CTGGGTGTGCAGATGGGTCTGGG + Intronic
1141972230 16:87492184-87492206 CGGCGTGTACCGCTGGTTCTCGG - Intergenic
1142144325 16:88486519-88486541 CTGGGTGCACAGTGGGTGCTAGG + Intronic
1142144353 16:88486657-88486679 CTGGGTGCACAGTGGGTGCTAGG + Intronic
1143372090 17:6446784-6446806 CTTGGTGTACAGGGGGTGCTGGG + Intronic
1147583270 17:41638591-41638613 CTGGGTATACAGGGGGTGCTGGG - Intergenic
1148884348 17:50760703-50760725 CAGGGTGAGCTGATGGTGCTAGG - Intergenic
1151416971 17:73972922-73972944 CGGAGTGTAGAGTTGGTTCTTGG - Intergenic
1151464293 17:74274565-74274587 CAGGGTGTACAGAGGCTGCAGGG - Intronic
1151499778 17:74481366-74481388 CGGAGGGTACAGAGGCTGCTGGG + Intronic
1152341541 17:79728570-79728592 CGGGGTGCACAGAAGGGGCCTGG - Intergenic
1154163413 18:11996542-11996564 CGGGGTGGGCAGGTGGTGGTGGG - Intronic
1166309682 19:41955977-41955999 CTGGGTGCACAGTTGGTCCTTGG + Intergenic
1168129003 19:54305524-54305546 CGGGGGTCACAGAAGGTGCTGGG - Intergenic
1168475704 19:56673573-56673595 CTAGGGGAACAGATGGTGCTGGG + Intergenic
925148801 2:1600784-1600806 CAGGGTCTAAACATGGTGCTGGG + Intergenic
926298771 2:11587584-11587606 CGGGGAGTAAAGCTGGTGCCTGG - Intronic
927668077 2:25045938-25045960 CGGGGTGCACAGACTGTGGTTGG - Intronic
928819883 2:35348005-35348027 TGGGGTGAAAAGGTGGTGCTTGG - Intergenic
934020035 2:87939480-87939502 CTGTGTGACCAGATGGTGCTAGG - Intergenic
937122771 2:119452215-119452237 GGGGGTGTTCTAATGGTGCTGGG - Intronic
937290305 2:120777937-120777959 CTGGGGGTACAGAAGTTGCTGGG + Intronic
1171277201 20:23867476-23867498 CTGGGTGCTCACATGGTGCTGGG - Intergenic
1172958764 20:38782179-38782201 CAGGGTGTAAAGATGGTGCAGGG + Intergenic
1175217649 20:57400019-57400041 AGAGAAGTACAGATGGTGCTGGG - Intronic
1176233793 20:64044978-64045000 AGGGGTGTGCAGCTGGTGCCAGG + Intronic
1177723370 21:24936213-24936235 ATGTGTGTACAGCTGGTGCTGGG + Intergenic
1181172443 22:21017279-21017301 AGGGCTGGCCAGATGGTGCTGGG - Intronic
1183778514 22:39983703-39983725 CTGTGGGTACAGATGGTGGTGGG - Intergenic
1183964650 22:41434494-41434516 CTAGGGGAACAGATGGTGCTGGG + Exonic
1184244721 22:43230251-43230273 AGGGGAGTTCAGATGGGGCTGGG - Intronic
952528437 3:34238466-34238488 AGGGGTGTAGAGATTGGGCTGGG - Intergenic
953016990 3:39086946-39086968 GGAGTTGTTCAGATGGTGCTTGG + Intronic
953795891 3:45985629-45985651 CTGGGTGTGCAGATGCTGCCTGG + Intronic
954214138 3:49115151-49115173 CTGGGTGTGCAGTGGGTGCTAGG - Intronic
961358650 3:126354330-126354352 CTGGGTGTAGAGGTGATGCTGGG - Intronic
969901814 4:10356980-10357002 ATGGGGGTACAGGTGGTGCTTGG + Intergenic
986348066 5:6852892-6852914 CAGGCTGTGCAGAAGGTGCTGGG + Intergenic
988442574 5:31249640-31249662 AGGGAAGTACAGATGCTGCTAGG - Intronic
988918433 5:35919487-35919509 CAGGGTGGAAAGATGGTGCCGGG + Intronic
996747578 5:126858388-126858410 CGGGGGCTACAGAAGGTGCGGGG + Intergenic
996834861 5:127779757-127779779 TTGGGGGTACAGATGGTGTTTGG + Intergenic
998070548 5:139194661-139194683 TGGGGGCTCCAGATGGTGCTTGG - Intronic
999416861 5:151405874-151405896 TGGGTTTTACAGATGTTGCTTGG + Intergenic
1001518467 5:172373715-172373737 CCTGGTGCACAGTTGGTGCTCGG + Intronic
1006604428 6:35245858-35245880 TGGGCTGTACAGCTGGTGGTGGG - Intronic
1006912404 6:37571934-37571956 CGGTGAGCACAGATGGTGCAAGG - Intergenic
1007397882 6:41587649-41587671 CGGGGTGTACAGATGGTGCTTGG + Intronic
1013053894 6:106564468-106564490 GGGAGTGAACTGATGGTGCTTGG + Intronic
1015305596 6:131703704-131703726 CTGAGTTTACTGATGGTGCTGGG + Intronic
1021964627 7:25905517-25905539 CAGGGTGGACAGCTGGTGCCCGG + Intergenic
1022953374 7:35359899-35359921 CTGGGGGAACAGGTGGTGCTTGG + Intergenic
1024387932 7:48774861-48774883 CGGGGTGTGAAGCTGCTGCTGGG - Intergenic
1026773389 7:73216095-73216117 CGGGGTCTCGAGATGCTGCTCGG - Intergenic
1027014248 7:74769491-74769513 CGGGGTCTCGAGATGCTGCTCGG - Intergenic
1027073785 7:75176541-75176563 CGGGGTCTCGAGATGCTGCTCGG + Intergenic
1031145480 7:117993126-117993148 TGAGGTTTCCAGATGGTGCTAGG - Intergenic
1033739712 7:144261935-144261957 CTGAGTTTACTGATGGTGCTGGG + Intergenic
1036696556 8:10978985-10979007 GGGGGTGGACAGATGGGTCTGGG - Intronic
1039842609 8:41304575-41304597 CGGGGAGTGCAGGTGGGGCTTGG + Intronic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1047689739 8:127339633-127339655 AGGAATGTACAGATGGAGCTAGG + Intergenic
1048868511 8:138778379-138778401 CGGGGAGTCCAGGTGGTCCTTGG + Exonic
1057810617 9:98254164-98254186 AGGGGTGGACAGATGGGGATGGG + Intronic
1058172540 9:101700047-101700069 GGGGTTGTACAGAGGGTGATGGG - Intronic
1198329125 X:135605432-135605454 CGGGGTGTTCAGGAGGTGTTAGG - Intergenic
1199124490 X:144099650-144099672 CTGTGTGACCAGATGGTGCTAGG + Intergenic