ID: 1007398099

View in Genome Browser
Species Human (GRCh38)
Location 6:41588647-41588669
Sequence CCAGGGCGTGCTCTGTGTTG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 305}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007398099_1007398106 4 Left 1007398099 6:41588647-41588669 CCTCAACACAGAGCACGCCCTGG 0: 1
1: 0
2: 0
3: 18
4: 305
Right 1007398106 6:41588674-41588696 CCGGAGTACAGCCCAGTGCCGGG 0: 1
1: 0
2: 0
3: 18
4: 258
1007398099_1007398109 16 Left 1007398099 6:41588647-41588669 CCTCAACACAGAGCACGCCCTGG 0: 1
1: 0
2: 0
3: 18
4: 305
Right 1007398109 6:41588686-41588708 CCAGTGCCGGGTACAGATGCAGG 0: 1
1: 0
2: 1
3: 11
4: 135
1007398099_1007398104 3 Left 1007398099 6:41588647-41588669 CCTCAACACAGAGCACGCCCTGG 0: 1
1: 0
2: 0
3: 18
4: 305
Right 1007398104 6:41588673-41588695 ACCGGAGTACAGCCCAGTGCCGG 0: 1
1: 0
2: 0
3: 4
4: 88
1007398099_1007398110 19 Left 1007398099 6:41588647-41588669 CCTCAACACAGAGCACGCCCTGG 0: 1
1: 0
2: 0
3: 18
4: 305
Right 1007398110 6:41588689-41588711 GTGCCGGGTACAGATGCAGGTGG 0: 1
1: 0
2: 0
3: 10
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007398099 Original CRISPR CCAGGGCGTGCTCTGTGTTG AGG (reversed) Exonic
900562070 1:3312176-3312198 CCAGGCCGAGCTCTGTGCTTTGG - Intronic
901674589 1:10875485-10875507 CCTGGGCTTGCTATGTGCTGGGG + Intergenic
902706029 1:18205211-18205233 CCATGGCTTTCTCTGTGTAGTGG + Intronic
902763811 1:18601604-18601626 CCAAGGAGGCCTCTGTGTTGGGG + Intergenic
903500115 1:23796060-23796082 CCAGGGCGGGCTGTGGGGTGGGG - Intronic
903667616 1:25017551-25017573 CCAGTGGGGGCTCTGTGGTGTGG - Intergenic
904346946 1:29878985-29879007 CCAGGGTGTGTCCTGTGGTGAGG + Intergenic
904447849 1:30588950-30588972 CCAGGGTGTGTCCTGTGGTGAGG - Intergenic
904604609 1:31691744-31691766 CCAGGGTGGGCTCTGGTTTGGGG - Intronic
906265478 1:44425506-44425528 CCAGGAGGTGCCCAGTGTTGTGG - Intronic
907315445 1:53567970-53567992 CCAAGGGGGGCTCTGTGTGGGGG - Intronic
907994570 1:59616468-59616490 CCAGGGCCTGCTGTGGGGTGAGG + Intronic
908487629 1:64610804-64610826 CCAGTGGGTACTCTGTGTGGGGG + Intronic
909269160 1:73600846-73600868 CCAGTGGGAGCTCTGTGTTGGGG + Intergenic
909654916 1:78021136-78021158 CCAGGGCCTGTTGTGGGTTGGGG - Intronic
911678176 1:100683100-100683122 CTACGGGGTGTTCTGTGTTGAGG - Intergenic
913307812 1:117450941-117450963 CCAGCAGGTACTCTGTGTTGGGG - Intronic
914079313 1:144391846-144391868 CTGGGGCCTGCTCTGTGGTGGGG + Intergenic
914099866 1:144574656-144574678 CTGGGGCCTGCTCTGTGGTGGGG - Intergenic
914174214 1:145260393-145260415 CTGGGGCCTGCTCTGTGGTGGGG + Intergenic
914528878 1:148501577-148501599 CTGGGGCCTGCTCTGTGGTGGGG + Intergenic
914637515 1:149565531-149565553 CTGGGGCCTGCTCTGTGGTGGGG - Intergenic
915509941 1:156381426-156381448 CCAGGGAGTAGTATGTGTTGAGG - Exonic
917975466 1:180235016-180235038 CCCGGGCGTGCTCTGGGTTTTGG + Intronic
919014825 1:192019007-192019029 CCAGGGCCTGCTGTGGGGTGGGG + Intergenic
920344639 1:205298461-205298483 CCAGGCAGTCCTCTGTGTAGAGG - Intergenic
920800539 1:209183445-209183467 CCAGTGGGGACTCTGTGTTGGGG - Intergenic
922709116 1:227813839-227813861 CCAGTGGGGGCTCTGTGTGGGGG + Intergenic
922826131 1:228520843-228520865 CCAGGGCCTGCTGTGGGGTGGGG - Intergenic
924863720 1:247955102-247955124 CCAGGGCCTGCTGTGGGGTGGGG - Intronic
1063437987 10:6049993-6050015 CCAAGGCGTGCTATGTGCTGAGG + Intronic
1064779546 10:18819762-18819784 CCAGGGCGTGTTGTGGGGTGGGG + Intergenic
1066684243 10:37965266-37965288 CCAGTGGGGGCTCTGTGTGGAGG - Intronic
1067342790 10:45418573-45418595 CCTGGGCGTCCTCTCTGATGGGG + Intronic
1068369026 10:56090087-56090109 CCAGGGCCTGTCCTGGGTTGGGG + Intergenic
1069106124 10:64385149-64385171 CCAGTGGGGGCTCTGTGTTGGGG + Intergenic
1073260685 10:102188235-102188257 CCAGGGCCTCCTCTCTGCTGAGG - Intergenic
1073559765 10:104486851-104486873 CCTGGGCTTGCTGTGGGTTGGGG + Intergenic
1075100295 10:119501915-119501937 CCAGGTCTTTCTCTGGGTTGTGG - Intronic
1076704234 10:132292697-132292719 CCAGGGCCTGCTTTGGGTGGGGG - Intronic
1076781435 10:132726936-132726958 TCATGCCTTGCTCTGTGTTGAGG + Intronic
1077251827 11:1564187-1564209 CCATGGCTTGCTGTGTGGTGTGG - Intronic
1078185741 11:9050802-9050824 TCAGGGTGTGCTGTGTGTGGTGG - Intronic
1078471667 11:11592530-11592552 CCAGGGCGTGTGCTGTGTGTGGG - Intronic
1078549236 11:12269082-12269104 CCAGGGCCTGGTGTGGGTTGGGG - Intergenic
1079035906 11:17019910-17019932 CTAGGGCGTTCTCAGTATTGTGG + Intergenic
1079292947 11:19204815-19204837 CCAGGGCCTGCTGTGGGGTGGGG + Intronic
1079713707 11:23718296-23718318 CCAGTGGGGACTCTGTGTTGGGG - Intergenic
1081388131 11:42497048-42497070 CCAGGGCCTGTTGTGGGTTGTGG + Intergenic
1081774876 11:45670148-45670170 GCAGGGAGTGGTCTGTGCTGGGG + Intergenic
1083363830 11:62129441-62129463 CAAGGGCGTGCTCTGGATTAAGG + Intronic
1083594365 11:63911926-63911948 CCAGGGCGGGCGCTGTGGCGGGG + Exonic
1083664594 11:64267583-64267605 CCAGGGCGGGCGCTGGGTGGAGG + Intronic
1084757324 11:71248087-71248109 CCAGGGCAGGCTCTGGGTAGTGG + Intronic
1084951457 11:72668492-72668514 CCCTGGCTTGCTATGTGTTGGGG - Intronic
1086260365 11:84932514-84932536 CCAGGGCCTGTTGTGTGGTGGGG - Intronic
1086297623 11:85388281-85388303 GCAGGGCTTGCTTTGTTTTGGGG - Intronic
1087336615 11:96852025-96852047 CCAGTGGGGGCTCTGTGTAGGGG - Intergenic
1087807268 11:102568724-102568746 CCAGTGAGGACTCTGTGTTGGGG + Intergenic
1087820498 11:102706314-102706336 CTAGGGCTTGCTCTGGGTTTTGG + Intergenic
1088038768 11:105350841-105350863 CCAGTGTGGACTCTGTGTTGGGG + Intergenic
1089125693 11:116174938-116174960 CCCAGGAGTGCTCAGTGTTGAGG - Intergenic
1089498318 11:118918852-118918874 CAAGGGTGTGGTCTGGGTTGGGG + Intronic
1090461184 11:126892884-126892906 CCAGGCAGTGCTCTGTGTCTAGG - Intronic
1090692612 11:129199720-129199742 CCAGTGGGGGCTCTGTGTGGGGG - Intronic
1091138714 11:133217258-133217280 CCAGTGGGTGCTTTGTTTTGGGG - Intronic
1091347314 11:134864126-134864148 CCAGGGACAGCTCTGTGTTATGG - Intergenic
1092706099 12:11286464-11286486 CCAGGGCCTGTTGTGTGGTGGGG + Intergenic
1093330191 12:17826610-17826632 CCAGGGCCTGTTGTGGGTTGGGG + Intergenic
1093384543 12:18535945-18535967 CCAGGGCCTGCTGTGGGGTGGGG + Intronic
1094738338 12:33260202-33260224 CCAGTGGGAACTCTGTGTTGGGG - Intergenic
1096970247 12:55659758-55659780 CCAGGGCCTCCCCTGTGTCGAGG - Intergenic
1097377937 12:58860683-58860705 CCAGGGGGAACTCTGTGTGGGGG + Intergenic
1097820176 12:64120698-64120720 CCAGGGCTTGCCCAGTGTTAGGG - Intronic
1098130476 12:67344990-67345012 CCAGGGCCTGTCCTGTGGTGAGG - Intergenic
1099390140 12:82069772-82069794 CCAGTGGGTACTCTGTGTGGGGG + Intergenic
1099658706 12:85527822-85527844 CCAGTGAGGGCTCTGTGTGGGGG - Intergenic
1099696130 12:86021575-86021597 CCAGGGCCTGCTGTGGGGTGGGG + Intronic
1101217840 12:102602833-102602855 CTAGAGCCTGCTCTGTGTTTAGG - Intergenic
1102533298 12:113562705-113562727 CCAGGACATGCTCTGAGCTGGGG - Intergenic
1103008758 12:117441684-117441706 CCAGGGCATCCAATGTGTTGGGG - Intronic
1106317207 13:28605164-28605186 CCAGGGCCTGTTGTGTGGTGGGG - Intergenic
1110359678 13:74610924-74610946 CCAGTGGATACTCTGTGTTGGGG - Intergenic
1110467010 13:75813674-75813696 CCAGGCTGTGCTCCGTGTTGGGG + Intronic
1110676537 13:78252976-78252998 CAATGGAGTGCTCTGTTTTGGGG + Intergenic
1110983494 13:81934099-81934121 CCAGGGCGTGGTAGGGGTTGGGG + Intergenic
1111239683 13:85457858-85457880 CCAGTGGGGGCTCTGTGTGGGGG - Intergenic
1111419870 13:87998583-87998605 CCAGTGGGTACTCTGTGTAGAGG - Intergenic
1111819332 13:93194209-93194231 CCAGTACGGACTCTGTGTTGTGG - Intergenic
1113029366 13:105976574-105976596 CCAATGCGGGCTCTGTGTGGGGG + Intergenic
1113409832 13:110075263-110075285 CCAGGGCCTGGTGAGTGTTGGGG - Intergenic
1113443497 13:110347641-110347663 CCAGGGCATGCAGTGTGTGGTGG - Intronic
1113497516 13:110743550-110743572 CCAGTGCGGACTCTGTGTGGGGG + Intergenic
1113692673 13:112322769-112322791 CCATGGCATGCCCTGTGCTGGGG + Intergenic
1114792229 14:25672390-25672412 CCCGGGAGTGCTCTGGGTAGGGG + Intergenic
1120392840 14:83929971-83929993 CCAGTAGGTACTCTGTGTTGGGG - Intergenic
1120408118 14:84115184-84115206 CCAGGGCGTGTTTTGAGGTGGGG - Intergenic
1122875873 14:104664621-104664643 CCAGGGCCTGCCCTGGGATGCGG - Intergenic
1123486541 15:20745260-20745282 CCAGGGCCTGTTGTGGGTTGGGG - Intergenic
1123885689 15:24725718-24725740 CCAGGGCCTGTTGTGTGGTGGGG - Intergenic
1124583599 15:30985098-30985120 CCAGGGCATGCTCTTTTTTAAGG - Intronic
1126513056 15:49502176-49502198 CCAGTGGGTACTCTGTGTGGGGG - Intronic
1129268651 15:74408219-74408241 CCAGGGCATGCCGAGTGTTGGGG + Intergenic
1129332379 15:74834251-74834273 CCAGGGCTGGCTCTGTGCTTGGG + Intergenic
1130401619 15:83560305-83560327 CCAGGGAGTTCTCTGTTTTCTGG + Intronic
1130542072 15:84827424-84827446 CCAGGCTGTGCTGTTTGTTGTGG + Intronic
1130777360 15:86999009-86999031 CCAGGGCCTGCTATGGGGTGGGG - Intronic
1131852406 15:96557020-96557042 CCAGGGCCTGTTGTGGGTTGCGG - Intergenic
1133515574 16:6505832-6505854 CCAGGTCCTACTCAGTGTTGGGG + Intronic
1133794189 16:9033104-9033126 CCAGTGGGAGCTCTGTGTGGGGG - Intergenic
1137345545 16:47654789-47654811 CCAGGGCCTGTTGTGTGGTGGGG + Intronic
1137551903 16:49443181-49443203 CCAGGGCGTGCTCAGGTCTGAGG + Intergenic
1137804103 16:51287473-51287495 AGAGGGCGTGCGCTGTGCTGGGG - Intergenic
1141420625 16:83913080-83913102 GCAGGGTGTTCACTGTGTTGGGG + Intronic
1142328232 16:89432410-89432432 CCGTGGCATGCACTGTGTTGAGG + Intronic
1142435614 16:90055081-90055103 CCAGTGGGGACTCTGTGTTGGGG - Intergenic
1144225266 17:13139112-13139134 CCAGTGGGTACTCTGTGTGGTGG - Intergenic
1144891254 17:18495696-18495718 CCAGAGGGGGCTCTGTGTGGGGG - Intergenic
1145140970 17:20448621-20448643 CCAGTGGGGGCTCTGTGTGGGGG + Intergenic
1146601180 17:34218041-34218063 CCAGGGAGCTCTGTGTGTTGGGG + Intergenic
1146683753 17:34826686-34826708 CTGGGCTGTGCTCTGTGTTGTGG - Intergenic
1147310214 17:39591595-39591617 CCAGGGCCTGCCCTTTGCTGGGG + Intergenic
1147426898 17:40350235-40350257 CCAGGCCGTGCTTGGTTTTGGGG + Intronic
1150142262 17:62739936-62739958 CCAGGGTATGCGCGGTGTTGCGG + Intronic
1150529188 17:65959057-65959079 CCAGGGCCTACTCTCTGCTGAGG + Intronic
1154020425 18:10659992-10660014 CCAGGGCTTGCTATTTGTTCAGG - Intergenic
1157492755 18:48136024-48136046 CCACGCCGTGCTCTGTGGTGAGG - Intronic
1157941129 18:51930183-51930205 CCAGTGGGGACTCTGTGTTGGGG - Intergenic
1158557938 18:58490573-58490595 CCAGGGCTTGGTTTCTGTTGGGG - Intronic
1159865033 18:73693331-73693353 CCCAGGCTTGCTCAGTGTTGGGG + Intergenic
1161580551 19:5078310-5078332 CGGGAGCGTGCTCTGTGGTGAGG + Intronic
1162907362 19:13831641-13831663 CCAGGGTGGGCTCAGGGTTGGGG + Exonic
1163394077 19:17048914-17048936 ACAGGGCTTGCTCTGTCTTCTGG - Intergenic
1164086103 19:21903988-21904010 CCAGTGCAGACTCTGTGTTGGGG + Intergenic
1164696818 19:30251142-30251164 CCAGGGAGTGCTCTGTGATCAGG - Intronic
1166110468 19:40619708-40619730 ACAGGGTGTGCACTGTGTTCAGG + Intronic
1167622528 19:50567722-50567744 GCAGGGCGAGTTCTGTGCTGTGG - Intronic
1167882569 19:52472632-52472654 CCATGGCATGCTCTATTTTGAGG + Intronic
925950520 2:8905642-8905664 CCAGGGCCTGTTGTGTGGTGGGG + Intronic
926340802 2:11902920-11902942 CCCTGGGGTGCTCTGTCTTGGGG + Intergenic
926859235 2:17291561-17291583 CCAGGGCCTCCTCTCTGCTGAGG - Intergenic
927922673 2:26985526-26985548 CCAGGGGTTGCTCTGAGTTATGG - Intronic
928265437 2:29807433-29807455 CCAGGGAGGGCTCTGTGCTCAGG + Intronic
929227045 2:39521677-39521699 CCAGTGGGGACTCTGTGTTGGGG + Intergenic
929583615 2:43100543-43100565 TCAGGGAGTCCTCTGTGGTGAGG + Intergenic
930018435 2:46986492-46986514 TCAGGCAGTGCTCTGTGCTGGGG + Intronic
930352459 2:50274382-50274404 CCAGGGCCTGCTGGGGGTTGGGG + Intronic
931186253 2:59954245-59954267 CCAGGGCTTAGGCTGTGTTGAGG + Intergenic
931955450 2:67418957-67418979 CCAGTGGGGACTCTGTGTTGGGG + Intergenic
932720517 2:74135582-74135604 CCAGGGCGTGGTCAGCGTTTGGG + Exonic
936811464 2:116407835-116407857 CAAGTGGGTACTCTGTGTTGGGG - Intergenic
938295343 2:130174806-130174828 CCAGGCAGTGCTCGGGGTTGGGG + Intronic
938310505 2:130285823-130285845 CCAGGGCATTCTCTGTGTCTTGG + Intergenic
938444422 2:131366544-131366566 CCAGGGCATTCTCTGTGTCTTGG - Intergenic
938461277 2:131499039-131499061 CCAGGCAGTGCTCGGGGTTGGGG - Intergenic
940484116 2:154275681-154275703 CCAGGGGGGACTCTGTGTGGGGG - Intronic
940485234 2:154288939-154288961 CCAGGGGGGACTCTGTGTGGGGG + Intronic
940691358 2:156924294-156924316 CCAGTGGGGACTCTGTGTTGGGG - Intergenic
940783605 2:157959086-157959108 CCAGTGGGAGCTCTGTGTTGGGG + Intronic
944477757 2:200124823-200124845 CCAGTGGGGGCTCTGTGTGGGGG + Intergenic
946431752 2:219630068-219630090 CCAGGCCGTGCTCTGAGCTGAGG + Exonic
947998390 2:234547518-234547540 TGAGGGCGTGCTGTGTGTGGTGG + Intergenic
948355613 2:237374754-237374776 CCAGGGCGGCCCCGGTGTTGGGG + Exonic
1170840506 20:19921517-19921539 CCAGGGACTGCTCTGAGCTGAGG + Intronic
1172763253 20:37336627-37336649 CCAGGCAGGGCTCTGTGGTGGGG - Intergenic
1172842676 20:37911535-37911557 CCAGGGCATCCTCGGCGTTGGGG - Intronic
1174144662 20:48443341-48443363 CCAGGACATGCTCTTTGTTCTGG - Intergenic
1175305517 20:57973273-57973295 CCAGGGCCTGCCCTGTGTCTTGG - Intergenic
1177236110 21:18391713-18391735 CCAGGGGGGACTCTGTGTGGGGG + Intronic
1177401765 21:20614208-20614230 CTAGGTAGTGCTCTGTGTGGGGG - Intergenic
1177522109 21:22239309-22239331 CCAGTGGGGGCTCTGTGTGGGGG - Intergenic
1177918712 21:27123952-27123974 CCAGTGGGGACTCTGTGTTGGGG + Intergenic
1179545083 21:42108265-42108287 CCTGGGGGTGCTCCGGGTTGGGG - Intronic
1180185822 21:46138760-46138782 CCTGGGCGTGCTGGGTGTTTGGG - Intronic
1182875921 22:33690923-33690945 TGAGCGCCTGCTCTGTGTTGTGG - Intronic
1185005833 22:48276552-48276574 TCAGGGCCTGGCCTGTGTTGTGG + Intergenic
1185234888 22:49705941-49705963 CCAGCGAGTGCTCTGAGTGGAGG - Intergenic
949341953 3:3039796-3039818 CCAGAGCTTGCTCTTTGATGGGG - Intronic
949617145 3:5766269-5766291 CCAGGGCGTGTTGGGGGTTGGGG + Intergenic
950578745 3:13849461-13849483 CAAGTGCTTGCTCTGTCTTGGGG - Intronic
951661205 3:25068692-25068714 CCAGGCAGTGCTTTGTGCTGAGG - Intergenic
953993224 3:47499774-47499796 CCAGGCCGGGGTCTGAGTTGGGG + Intronic
954643783 3:52118221-52118243 CCAGGCCATGCTCTGGGCTGAGG - Intronic
955402670 3:58604349-58604371 CCAGGACATGCTCTGAGCTGAGG - Intronic
958061889 3:88494432-88494454 CCAGGGCCTGTTGTGGGTTGGGG - Intergenic
960581476 3:119282841-119282863 CCAGTGGGGGCTCTGTGTGGGGG - Intergenic
961503792 3:127356693-127356715 CCAGTGGGGACTCTGTGTTGGGG + Intergenic
961662500 3:128477053-128477075 CCAGGGCTGGCTCTGGGTTCTGG + Intergenic
962003658 3:131326773-131326795 CTAGGTCATGCTCTGTGCTGTGG + Intronic
962642115 3:137398504-137398526 CCAGGGCCTGTTGTGTGGTGGGG + Intergenic
962900933 3:139760891-139760913 CCAGGTCCTGCTGTGTGATGTGG + Intergenic
963907373 3:150783761-150783783 CCAAGGAGGGCACTGTGTTGAGG - Intergenic
964457050 3:156880027-156880049 CCAGTGGGTACTCTGTGTTGGGG - Intronic
966302715 3:178496951-178496973 CCAGTGAGGACTCTGTGTTGGGG - Intronic
966547001 3:181160505-181160527 CCAGGGCCTGCTGTGGGGTGGGG - Intergenic
967564677 3:190959663-190959685 CCAGTGGGAGCTCTGTGTGGGGG - Intergenic
967972934 3:195012511-195012533 CCAGGTCATTCTCTGTGCTGTGG - Intergenic
968588680 4:1446825-1446847 CCAGCACCTGCTCTGTGCTGGGG - Intergenic
968917151 4:3501561-3501583 CCTGGGGGTGCTCGGGGTTGGGG + Intergenic
969423640 4:7111321-7111343 CCAGGCCGTGCTCTGTGGTTGGG + Intergenic
969660342 4:8523642-8523664 CCAGGCAGTGCTCAGTCTTGTGG + Intergenic
972799799 4:42462652-42462674 CCAGGGGGAACTCTGTGTGGGGG - Intronic
972915689 4:43875824-43875846 CCAATGGGTGCTCTGAGTTGAGG + Intergenic
974768281 4:66377309-66377331 CCAGGGCCTGCTTAGGGTTGGGG + Intergenic
979418940 4:120479324-120479346 CCAGGGCCTGTTGTGTGGTGGGG + Intergenic
980767076 4:137320963-137320985 CCAGTGGGGACTCTGTGTTGGGG + Intergenic
981131399 4:141161990-141162012 CCATTGCGGACTCTGTGTTGGGG - Intronic
982504910 4:156205415-156205437 CCAGTGGGTACTCTGTGTGGGGG + Intergenic
982627526 4:157786137-157786159 CCAGTGGGTACTCTATGTTGAGG + Intergenic
982823238 4:159970517-159970539 CCAGGGCTTGCTCTAGGTTGTGG + Intergenic
983962197 4:173768357-173768379 CCAGGGCCTGTTGTGGGTTGGGG - Intergenic
984551266 4:181161913-181161935 CAAGTGAGTGCTCTATGTTGTGG + Intergenic
985111589 4:186552537-186552559 CAAGGGCGTGCTCTGTTTGCTGG - Intronic
985514681 5:335445-335467 CCAGGTGGTGGACTGTGTTGTGG + Intronic
985795907 5:1961998-1962020 GCAGGGGGTGCTCTGTGGAGAGG - Intergenic
988473857 5:31565535-31565557 CCAGTGGGGACTCTGTGTTGGGG + Intergenic
992022341 5:72636927-72636949 CCAGGGCCTGCTGTGGGGTGGGG + Intergenic
994338802 5:98601094-98601116 CCAGTGGGGACTCTGTGTTGGGG - Intergenic
994549169 5:101208803-101208825 CCAGTGAGTACTCTGTGTGGGGG - Intergenic
997929947 5:138064292-138064314 CCAGGCCAGGCACTGTGTTGAGG + Intergenic
998755110 5:145369277-145369299 CCAGGGCCTGTTGGGTGTTGAGG - Intergenic
998789417 5:145749951-145749973 CCAGGGCCTGTTGTGTGGTGGGG + Intronic
1000343275 5:160294156-160294178 CCAGGTCGTGCTGTGTACTGAGG - Intronic
1001772945 5:174309432-174309454 CCAGGGCCTGGCCTGTGCTGTGG + Intergenic
1002196587 5:177504642-177504664 CCAGGGCGTGTTCTCCTTTGAGG - Exonic
1005218025 6:23554510-23554532 CCAGTGGGGACTCTGTGTTGGGG + Intergenic
1005240657 6:23821449-23821471 CCAGGGCGTGTTGTGGGGTGGGG + Intergenic
1006474975 6:34247723-34247745 CCATGGTGGGCTATGTGTTGGGG - Exonic
1006581338 6:35079399-35079421 CCAGGGGGCCCTCTGTGTTTGGG - Intronic
1007398099 6:41588647-41588669 CCAGGGCGTGCTCTGTGTTGAGG - Exonic
1009051609 6:58283034-58283056 CCAGTGGGGACTCTGTGTTGGGG - Intergenic
1009769119 6:68121908-68121930 CCAGTGGGTACTCTGTGTGGAGG + Intergenic
1010674055 6:78720854-78720876 CCAGTGGGGACTCTGTGTTGGGG - Intergenic
1010855123 6:80828457-80828479 CCAGGGCCTGTTGTGGGTTGGGG - Intergenic
1011032949 6:82942846-82942868 CCAGTGGGTACTCTGTGTGGGGG - Intronic
1012108660 6:95198367-95198389 CCAGTGGGGACTCTGTGTTGGGG - Intergenic
1012678040 6:102142094-102142116 CCAGGGCCTGTTGTGGGTTGGGG - Intergenic
1012780062 6:103546613-103546635 CCAGGGGGGACTCTGTGTGGGGG + Intergenic
1012811639 6:103966760-103966782 CCAGTGGGGACTCTGTGTTGGGG + Intergenic
1014668724 6:124272599-124272621 CCAGTGGGTACTCTGTGTGGGGG - Intronic
1016438173 6:144058988-144059010 CCTGGGGGTACTCTGTGTGGTGG + Intronic
1016728336 6:147400905-147400927 CTAGTGGGAGCTCTGTGTTGGGG + Intergenic
1016997611 6:149971170-149971192 CCTGGGCTGGCTCTGTGGTGTGG + Intronic
1018075319 6:160207281-160207303 CCAGTGGGTACTCTGTGTGGTGG + Intronic
1018575750 6:165258621-165258643 CCAGTGGGTACTCTGTGTGGAGG + Intergenic
1018731974 6:166658196-166658218 CCTGGGCGTGATTTGTGTTGGGG + Intronic
1019121279 6:169806703-169806725 CTGTGGAGTGCTCTGTGTTGTGG - Intergenic
1019255468 7:46968-46990 CCAGGCTGTGCCCTGTGGTGCGG + Intergenic
1019312298 7:368785-368807 CCAGGCGGGGCTCTGTGCTGCGG - Intergenic
1019938113 7:4269473-4269495 CCCAGGCGTGCTCTGGGTCGAGG + Intergenic
1020873731 7:13668225-13668247 CCAGGGCCTGCTGGGTGGTGGGG - Intergenic
1021055170 7:16037891-16037913 CCAGGGTGCCCTCTGTGTTCAGG - Intergenic
1023844073 7:44111414-44111436 CCAGGGCCTGCTCTATGGCGAGG - Intronic
1024226154 7:47328128-47328150 CCAGGCAGGGCTCTGTGTTCCGG + Intronic
1024729274 7:52236229-52236251 CCAGTGCGGACACTGTGTTGGGG - Intergenic
1027751582 7:82154461-82154483 CCAGGGCCTGTTGTGTGGTGGGG + Intronic
1028362291 7:89983779-89983801 CCAGGGCCTGTTGTGTGGTGGGG - Intergenic
1030430268 7:109437017-109437039 CCAGAGAGAGCTCTGTGGTGGGG - Intergenic
1031666789 7:124494657-124494679 CCAGGGCCTGTTCTGGGGTGGGG - Intergenic
1035045799 7:155964581-155964603 CCTGGGCGAGCCCTGTGCTGCGG + Exonic
1035343596 7:158182477-158182499 CCAGGGCCTGCTGAGGGTTGGGG - Intronic
1036106453 8:5845982-5846004 CCAGTGGGTACTCTGTGTTGGGG + Intergenic
1036799898 8:11782879-11782901 ACAGAGTGTGCTCTATGTTGTGG + Intronic
1036799917 8:11783076-11783098 ACAGAGTGTGCTCTATGTTGTGG + Intronic
1037810851 8:22086196-22086218 CCAGAGTGGGCTCTGTGCTGTGG - Intergenic
1038012844 8:23488337-23488359 CCAGGGCTTGCTCTTGGGTGTGG - Intergenic
1040515491 8:48130924-48130946 CCAGGTCCTACTGTGTGTTGGGG - Intergenic
1040569208 8:48592880-48592902 CCAGGGCTTGCTGTGAGATGTGG + Intergenic
1043085566 8:75827395-75827417 CCAGGGGGGACTCTGTGTGGGGG - Intergenic
1046584655 8:116135959-116135981 CCAGGGCCTGCTGTGGGGTGGGG + Intergenic
1047842223 8:128765820-128765842 CCAGGGCCTGTTGTGCGTTGGGG + Intergenic
1049266052 8:141668481-141668503 GCAGGAAGTGCTCTGGGTTGGGG + Intergenic
1049422096 8:142521538-142521560 CCAGGGCCTGCCATGTGCTGTGG + Intronic
1049865001 8:144929436-144929458 AGAGGGCGTACTGTGTGTTGGGG + Intergenic
1050863789 9:10471132-10471154 CCAGGGCCTGTTGTGGGTTGGGG + Intronic
1053573064 9:39329805-39329827 CCAGGTCATGGTCTGTGGTGCGG - Intergenic
1053624410 9:39853987-39854009 CCAGGTCATGGTCTGTGGTGCGG - Intergenic
1053754857 9:41295609-41295631 CCAGGGCCTGCTGTGTGGTGGGG - Intergenic
1053880458 9:42589240-42589262 CCAGGTCATGGTCTGTGGTGCGG + Intergenic
1053892211 9:42705094-42705116 CCAGGTCATGGTCTGTGGTGGGG - Intergenic
1054116095 9:61164418-61164440 CCAGGTCATGGTCTGTGGTGGGG - Intergenic
1054124080 9:61289206-61289228 CCAGGTCATGGTCTGTGGTGCGG + Intergenic
1054219485 9:62396710-62396732 CCAGGTCATGGTCTGTGGTGCGG + Intergenic
1054231229 9:62512463-62512485 CCAGGTCATGGTCTGTGGTGCGG - Intergenic
1054260381 9:62859906-62859928 CCAGGGCCTGCTGTGTGGTGGGG - Intergenic
1054331391 9:63760086-63760108 CCAGGGCCTGCTGTATGGTGGGG + Intergenic
1054591663 9:67018126-67018148 CCAGGTCATGGTCTGTGGTGCGG + Intergenic
1055638300 9:78298376-78298398 ACAGAGCCTCCTCTGTGTTGTGG + Intronic
1056398928 9:86208409-86208431 CCAGGGAGTCCTCTGAGATGGGG + Intergenic
1056614671 9:88153664-88153686 CCAGGGCCTGTTGTGGGTTGGGG + Intergenic
1056968260 9:91181769-91181791 GCAGGGCTTGCTGTGTGTTGGGG - Intergenic
1057042854 9:91859955-91859977 CCAGGGTGTGCTCAGTCCTGCGG + Intronic
1057090511 9:92254058-92254080 CCAGGTCATCCTCTGTGGTGGGG - Intronic
1057749486 9:97780127-97780149 CCAGTGGGGACTCTGTGTTGGGG - Intergenic
1060217805 9:121748908-121748930 CCAGGGCGTTCTGTGTGTATGGG + Intronic
1060393951 9:123302630-123302652 CCAGGCCTTGAGCTGTGTTGTGG - Intergenic
1061218966 9:129237834-129237856 CCAGGGCTTGCTCTCTGTACTGG + Intergenic
1062353831 9:136152556-136152578 TCAGGGCCTGGTCTGTGATGGGG + Intergenic
1202798767 9_KI270719v1_random:153016-153038 CCAGGGCCTGCTGTGTGGTGGGG + Intergenic
1185621804 X:1454263-1454285 CCAGGGCGGGCGCTGTGAGGTGG + Intergenic
1187259114 X:17668912-17668934 CCAGTGCGTGCCCTGTGTGTGGG + Intronic
1188134912 X:26483635-26483657 CCAGTGGGGGCTCTGTGTGGGGG - Intergenic
1188616534 X:32165115-32165137 CCAGTGGGGACTCTGTGTTGGGG - Intronic
1192376988 X:70572838-70572860 CCAGGGCCTGCTGTGGGGTGGGG + Intronic
1192391588 X:70734140-70734162 CCAGGGCCTGTTGTGGGTTGGGG + Intronic
1193259897 X:79392917-79392939 CCAGGGCCTGCTGTGGGGTGGGG + Intergenic
1193615239 X:83679730-83679752 CCAGGGCCTGCTGTGGGGTGGGG + Intergenic
1193730413 X:85095902-85095924 ACAGGGCGTTCTCTGTGTCAGGG - Intronic
1194300614 X:92181922-92181944 CCAGTGGGTACTCTGTGTGGGGG - Intronic
1194339791 X:92694037-92694059 CCAGTGGGTACTCTGTGTAGGGG + Intergenic
1195339380 X:103891271-103891293 CCAGGGCCTGTTGTGTGGTGGGG - Intergenic
1196019065 X:110970584-110970606 CCAGGGCCTGCTGTGGGTGGGGG + Intronic
1196168898 X:112565578-112565600 CCAGTGGGGACTCTGTGTTGGGG + Intergenic
1196547216 X:116976043-116976065 CCAGTGGGGACTCTGTGTTGGGG - Intergenic
1197016545 X:121632468-121632490 CCAGTGGGGACTCTGTGTTGGGG + Intergenic
1197543512 X:127794729-127794751 CCAGGGCCTGTTCTGGGTTTGGG + Intergenic
1198675512 X:139126518-139126540 CCAGGCCATGCCCTGTGTTCTGG - Intronic
1198919829 X:141713114-141713136 CCAGGACATGCTCTGTGTCCAGG - Intergenic
1198996388 X:142578521-142578543 CCAGTGGGAACTCTGTGTTGGGG - Intergenic
1199962744 X:152790624-152790646 CCAGGGATTTCTCTGTTTTGTGG + Intergenic
1199999339 X:153049618-153049640 CCAGTGGGAACTCTGTGTTGGGG - Intergenic
1200269165 X:154665286-154665308 CCAGGGCCTGTTGTGGGTTGGGG - Intergenic
1200648174 Y:5810820-5810842 CCAGTGGGTACTCTGTGTAGGGG + Intergenic
1200898950 Y:8408121-8408143 CCAGGGCCTGTTGTGGGTTGAGG - Intergenic