ID: 1007398983

View in Genome Browser
Species Human (GRCh38)
Location 6:41593072-41593094
Sequence GGTCAAAGTGGACCTCAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 111}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007398983_1007398989 17 Left 1007398983 6:41593072-41593094 CCAGCTTGAGGTCCACTTTGACC 0: 1
1: 0
2: 0
3: 9
4: 111
Right 1007398989 6:41593112-41593134 CAAATGCATTCATGTTACTTGGG No data
1007398983_1007398988 16 Left 1007398983 6:41593072-41593094 CCAGCTTGAGGTCCACTTTGACC 0: 1
1: 0
2: 0
3: 9
4: 111
Right 1007398988 6:41593111-41593133 CCAAATGCATTCATGTTACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007398983 Original CRISPR GGTCAAAGTGGACCTCAAGC TGG (reversed) Intronic
901061656 1:6474523-6474545 GGGCAAAGTGGACATCTACCTGG - Exonic
909602594 1:77476506-77476528 GCTAAAAGTGGAGCTGAAGCTGG - Intronic
909696217 1:78470786-78470808 GGTCAAAGTGTAGGTCAAGTGGG + Intronic
913498202 1:119447566-119447588 GGACAAAGTTGAACTGAAGCAGG + Intergenic
914829272 1:151158886-151158908 GATCAAAGTGGCCATCAAGGTGG + Exonic
914975004 1:152353197-152353219 GGCCAAAGTGGATCTCAACATGG - Exonic
1063714348 10:8513034-8513056 GTTCAAAGGGGACCTCAGGTGGG - Intergenic
1063947986 10:11196008-11196030 GGTAAAAGAGCACCTCAGGCAGG + Intronic
1066071624 10:31820440-31820462 GTTCACAGTGGACCTCAAGGGGG - Exonic
1067723598 10:48749619-48749641 GGTGAAAGTGGAGCAGAAGCAGG + Intronic
1068901827 10:62278051-62278073 GGTCAAGGCTGACCTCAAACAGG - Intergenic
1069766026 10:70861062-70861084 GGACAAAGTGAACCTGAACCTGG - Intronic
1070483282 10:76906167-76906189 GGTCCAAGTGGAGCTTAAGTTGG + Intronic
1073002945 10:100298809-100298831 GGGCAAACTGAACCACAAGCTGG + Exonic
1083091531 11:60204313-60204335 AGTCAAAGTTTACCTCAAGTTGG - Intronic
1083938624 11:65883262-65883284 GGACAGAGTGGTCCACAAGCTGG - Exonic
1085263684 11:75223925-75223947 AGCCAAAGTGGGCCTCAACCTGG - Intergenic
1088811173 11:113393718-113393740 GCTCCACCTGGACCTCAAGCCGG + Exonic
1089707151 11:120286937-120286959 AGCCACAGTGGACCACAAGCAGG + Intronic
1093623788 12:21322967-21322989 GGACAGGGTGGATCTCAAGCAGG - Intronic
1094425904 12:30316810-30316832 GGTCATAGTGGAGGTCAAGAAGG + Intergenic
1096958592 12:55553372-55553394 GGTAAAAGTGGAACACAATCTGG + Intergenic
1097074384 12:56381938-56381960 AGTCAAACAGGACCTCAACCAGG + Intergenic
1097725133 12:63066686-63066708 GGTCAGAGAGGAAGTCAAGCAGG + Intergenic
1099499775 12:83399603-83399625 AGTCACAGTGGAGCTAAAGCTGG + Intergenic
1102816517 12:115870385-115870407 GGTCAAAGTGACCCACAAACAGG + Intergenic
1111232520 13:85363025-85363047 GGCCAAAGGGCTCCTCAAGCCGG - Intergenic
1113467669 13:110523772-110523794 GGTCAAAGAGGGTCTCAAACAGG + Exonic
1113881269 13:113627966-113627988 GGGCAAGGTGGACCTCCGGCAGG + Intronic
1118418328 14:65570089-65570111 GTTTAAGGTAGACCTCAAGCAGG + Intronic
1118974512 14:70665213-70665235 GGTCAGAGAGGACTTCAGGCAGG + Intronic
1119123124 14:72098209-72098231 GTTCAAAGAGGACCTCCAGGAGG - Intronic
1119758579 14:77135692-77135714 GGCAAAGGTGGCCCTCAAGCTGG + Intronic
1130155353 15:81345571-81345593 GTTGAAAGTGGACATCAGGCTGG + Intronic
1132692460 16:1187687-1187709 GGTCAGAGTGGCCCCCAAGCAGG - Intronic
1134859068 16:17544962-17544984 GGTCAAAGAGGAACTCCACCAGG + Intergenic
1135350580 16:21725925-21725947 GGTCAAAGTCACCCTCAAGAAGG - Intronic
1136044114 16:27602037-27602059 GGTAAAAGTGGCCCTAAATCAGG + Intronic
1136578265 16:31137013-31137035 GGCCAGAGTGGCCCTCAAGGAGG - Intergenic
1141171490 16:81694444-81694466 GGTCAAACTGGACCTTAGTCTGG + Intronic
1141451365 16:84105679-84105701 GGGAAGAGAGGACCTCAAGCAGG + Intronic
1142341724 16:89527797-89527819 GATCAAAATGTACCTCTAGCCGG + Intronic
1143163587 17:4886577-4886599 GGTCAATGTGGTCCTTAAGCTGG - Exonic
1143519493 17:7437449-7437471 GGCCAAAGTGGCCCGCAAGGGGG + Exonic
1146273163 17:31497743-31497765 GGTGACAGTGGCCCCCAAGCAGG + Intronic
1148450027 17:47771062-47771084 AGTCAGAGTGGACCTAAAGAGGG - Intergenic
1148587462 17:48791150-48791172 TGTCTAAGAGGACCTCAAGAAGG + Intronic
1151474914 17:74339845-74339867 GGTCCAAAGGGACCTCAGGCAGG + Intronic
1153255755 18:3168931-3168953 CATCAAAGTGGATCTCAAACCGG + Exonic
1154512850 18:15127069-15127091 GGTCAAAGTGTACCTCAGAAAGG - Intergenic
1159241860 18:65751484-65751506 CCTCAAAGAGGACCACAAGCAGG + Intronic
1160037953 18:75318878-75318900 GTTCACAGTGCACCTGAAGCAGG - Intergenic
1160887881 19:1360434-1360456 GTGCAAAGTGGACCACAAGAAGG + Exonic
1161507545 19:4652058-4652080 GGTCAAGGTGGCCCTGAAGCTGG + Exonic
1161735786 19:5991405-5991427 AGCCACAGTGGACCTCAAGGTGG - Intergenic
1163594053 19:18210736-18210758 GGTCAGAGTGGACCCCAGCCAGG + Exonic
1166419739 19:42627092-42627114 GGGCAAAGTAGAACTGAAGCTGG - Intronic
926145727 2:10396252-10396274 GGGCAATGTGGGCCTCAAGGAGG + Intronic
927113750 2:19882633-19882655 GGTAAAAGTCTACCTCTAGCAGG - Intergenic
927429563 2:23015719-23015741 GGTCAAGGTGGAACTGAAGACGG - Intergenic
930024041 2:47019548-47019570 GGTCAGAGTGGATCACAAGTTGG + Intronic
932097696 2:68866230-68866252 TCTCAATGTGGACCTCCAGCTGG + Exonic
932440734 2:71733091-71733113 GCTCACAGTGGACCTCCCGCTGG + Intergenic
932698771 2:73978816-73978838 TGTCAAAATGGACCTCAAATGGG + Intergenic
935901756 2:107800160-107800182 GGTGCCAGTGGTCCTCAAGCTGG - Intergenic
938513102 2:131971707-131971729 GGTCAAAGTGTACCTCAGAAAGG - Intergenic
946308596 2:218870556-218870578 GGTCCTAGTGGACCACAAGCTGG - Intronic
946468128 2:219930781-219930803 TGGCAAAATGGAACTCAAGCAGG - Intergenic
947240690 2:227991116-227991138 GGTCAAAGTTGATCACCAGCAGG + Exonic
1169080654 20:2796215-2796237 GGACAGAGTGGCCCTCATGCTGG + Intronic
1173047141 20:39523402-39523424 GGTTAAAGTGGGCCTGAAGGGGG - Intergenic
1175837079 20:62003011-62003033 GGTCAAAGTGAGCGTGAAGCAGG + Intronic
1176096845 20:63348237-63348259 GATCAAAGCGGTCCTGAAGCTGG - Intronic
1177978352 21:27880245-27880267 GGTCAAAGTGTACCTCACAAAGG + Intergenic
1178440042 21:32591324-32591346 GGTCACAGAGGACCTCATTCAGG - Intronic
1181085317 22:20437018-20437040 GCTCGAAGTGGACCAGAAGCGGG - Intronic
1184275611 22:43407931-43407953 GGTCCAATTGGAACTCTAGCTGG + Intergenic
1184583320 22:45431187-45431209 GGACACTGTGGACCTCAAGTGGG + Intronic
1184859323 22:47164282-47164304 TGTCAAACAGGACTTCAAGCTGG - Intronic
951023382 3:17804891-17804913 GGTCAAAGAGGAAATCAAGATGG + Intronic
954583285 3:51715084-51715106 GGTCAAAGCGGACCTCATTGTGG - Exonic
955752465 3:62196667-62196689 GATCCAAGAGGACCTCAGGCTGG - Intronic
959374267 3:105568689-105568711 GGTCTAAGTAGACCAAAAGCTGG - Intronic
961008583 3:123421511-123421533 GGTCATAGTGGACCACACCCAGG - Intronic
961144550 3:124583389-124583411 GGTCCAAGTGGGCTTCAAGGGGG + Intronic
966882257 3:184357213-184357235 GGTCAAAGGGGAAGTCGAGCCGG + Exonic
967140698 3:186556473-186556495 AGTCAAACAGGACCTCAACCAGG + Exonic
968966715 4:3772579-3772601 GGACAACGGGGACCTCAAGATGG - Intergenic
976875085 4:89843915-89843937 AGTCAAAGTGGATTTCAAACTGG + Intergenic
977196309 4:94065154-94065176 GGTCAAAGAGGAGCCAAAGCAGG + Intergenic
981100076 4:140820156-140820178 GGACAAAATGGAACTCAAGTGGG - Intergenic
985715094 5:1452931-1452953 GGTCAAAGAGGACATCAAAAGGG - Intergenic
985758170 5:1731455-1731477 GGCCAAGGTGGTCCTCAAGGAGG + Intergenic
988196076 5:28007740-28007762 GGTCAAAGTGGAGTACCAGCAGG - Intergenic
993745014 5:91586459-91586481 GCTCAAAGTGCACCACAGGCAGG + Intergenic
1000662280 5:163951256-163951278 GGTCAAAGAGGTCGTCCAGCCGG - Intergenic
1001182731 5:169535842-169535864 AGCCAAAGTGGAATTCAAGCTGG + Intergenic
1001337833 5:170815160-170815182 GATTACAGTAGACCTCAAGCTGG + Intergenic
1003126537 6:3360689-3360711 AGACAAAGAGGCCCTCAAGCTGG + Intronic
1004311306 6:14547839-14547861 GTTCAAAGTGCTCCACAAGCTGG - Intergenic
1007398983 6:41593072-41593094 GGTCAAAGTGGACCTCAAGCTGG - Intronic
1009725373 6:67530966-67530988 GGTCAAGGTGGACCTGGAACTGG + Intergenic
1011553703 6:88552669-88552691 GGTCAGAGAAGACGTCAAGCAGG - Intergenic
1012455096 6:99394647-99394669 GTTCGAAGTTGACCTCAATCAGG + Intergenic
1017017425 6:150113143-150113165 GGTCCAGGTGCACCTGAAGCAGG - Intergenic
1017985810 6:159442253-159442275 GCTCAAAGAGGACACCAAGCTGG - Intergenic
1019200132 6:170307134-170307156 GGTCAGAGGTGACCTCAAGATGG - Intronic
1023880814 7:44320316-44320338 GGTCAGAGTAGACCACAAGCTGG + Intronic
1026277106 7:68889580-68889602 GGTCCATGTGGACCTAAGGCAGG - Intergenic
1033501048 7:141950091-141950113 GGTCATAGTGGAACTCAGACTGG - Intronic
1036713241 8:11096665-11096687 GGGCAAAGTGGACCTCATGGGGG - Intronic
1041335078 8:56773112-56773134 GGTCAAATTGGACCTGTGGCTGG - Intergenic
1047249413 8:123170426-123170448 GCCCAAAGTGGCCCTCAGGCTGG - Intergenic
1050767079 9:9147970-9147992 GGTGATAGTGGTTCTCAAGCTGG - Intronic
1051472428 9:17460632-17460654 GGCCAAAGTGTATCTCAACCTGG + Intronic
1052160028 9:25246479-25246501 GGGCAATGTGGACGTAAAGCTGG - Intergenic
1061654656 9:132079637-132079659 GGTCAACCGGGACCTCAAGTAGG - Exonic
1062497871 9:136840097-136840119 GGCCAACGGGGACCCCAAGCTGG - Intronic
1062536779 9:137024513-137024535 GGTCAGAGTAGACCACAAGCTGG - Intronic
1186233261 X:7479210-7479232 GGCCAAAGAGGACCTCAAACAGG + Intergenic
1197961311 X:132009207-132009229 AGACAAAATGGAGCTCAAGCAGG - Intergenic