ID: 1007400463

View in Genome Browser
Species Human (GRCh38)
Location 6:41599786-41599808
Sequence CTGGATGTGGGTGTGGAGCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 535
Summary {0: 1, 1: 1, 2: 4, 3: 49, 4: 480}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007400463 Original CRISPR CTGGATGTGGGTGTGGAGCC GGG (reversed) Exonic
900110466 1:1003320-1003342 CTGAGTGTGGGGGTGGATCCTGG + Intergenic
900158756 1:1213629-1213651 CTGGGTGGGGCTGTGGGGCCAGG + Intronic
900401288 1:2473963-2473985 CTGGGGGTGGGTGTGGACCATGG + Intronic
900411377 1:2514231-2514253 CTGGGGGTGGGTGTGGGCCCTGG - Intronic
900545710 1:3227992-3228014 TTGGATGTGACTGTGAAGCCTGG - Intronic
900988574 1:6087148-6087170 CAGGATGTGGGAGGGGGGCCTGG - Intronic
901379326 1:8862520-8862542 CTGTTTGTGGATGTGGAGCCAGG - Intronic
901419637 1:9142356-9142378 CTGGGTGTGAATGTGGGGCCAGG - Intergenic
902231770 1:15032099-15032121 CTGGGTGTGGGGGTGGATCGGGG - Intronic
902477486 1:16695993-16696015 CTGGGGGTGTGTGTGGAGACTGG + Intergenic
902618045 1:17634630-17634652 CTGGATATGGGGCTGGGGCCTGG + Intronic
903944315 1:26952119-26952141 CTGGGTGTGGGAGTGGTGCCGGG - Exonic
904200981 1:28818871-28818893 CTGGATGTGGGAGCTGAGGCTGG + Intronic
904349488 1:29895689-29895711 CCTGATGGGGGTGTGGAGCAGGG + Intergenic
904818242 1:33221276-33221298 CTGACTGTGGGTGGGGATCCTGG + Intergenic
905199409 1:36306265-36306287 CTGGGAGTGGGTGTGGAGAGGGG - Intergenic
906207738 1:43996113-43996135 CTGGACATGGGTGTGGAAGCTGG - Exonic
906294859 1:44643446-44643468 ATGGATCTGGCTGAGGAGCCTGG + Intronic
907188385 1:52629477-52629499 CTGGCTGTGTGTGTGGTCCCTGG - Intergenic
907283780 1:53367729-53367751 AGGGAGCTGGGTGTGGAGCCAGG - Intergenic
907498661 1:54862218-54862240 CTGGAGGCGGGTGTGGGGCCAGG - Intronic
908856306 1:68433560-68433582 CTGCATCTGAGTGTGGAGGCGGG + Intronic
910156574 1:84225616-84225638 CTGGGGGTGGGTGTGGGACCTGG + Intronic
910293919 1:85625988-85626010 CTGTATGGGGGTGGGGAGTCAGG - Intergenic
911266838 1:95753390-95753412 CTGGCTGCGGGTGTGGACCCAGG + Intergenic
912412164 1:109487041-109487063 CTGGAGGTGGGGGTGGGGCCCGG - Exonic
912629730 1:111236183-111236205 CTGGCTGTGGGGGTGGGGCTGGG + Intronic
916522503 1:165577517-165577539 CTGGATGTGGGGCTGGAAGCAGG + Intergenic
917685537 1:177412033-177412055 CTGGATGTGGATGCAGAGCTAGG - Intergenic
917837345 1:178951966-178951988 CTGCATGTGAGCGTGGAGCAGGG + Intergenic
918125150 1:181577141-181577163 CTGGATTTGGCTGTGGAACATGG + Intronic
919815603 1:201436667-201436689 CTAGAGGGAGGTGTGGAGCCAGG + Intergenic
920305395 1:205015200-205015222 CTGGGGGTGGGTGGGGAGCTGGG + Intronic
920414781 1:205791658-205791680 CTGGATGTGGGGCCGGGGCCTGG - Exonic
922339976 1:224647462-224647484 CTGGGTGTCGGGGTGGAGACTGG + Intronic
922668938 1:227494591-227494613 GTGCTTGTGGATGTGGAGCCGGG - Intergenic
922670660 1:227506711-227506733 GTGCTTGTGGATGTGGAGCCGGG + Intergenic
923030519 1:230245900-230245922 CTGGGTCTGGGTGGGGAGGCTGG + Intronic
923092684 1:230752050-230752072 CTGCATGTGCGTGTCGATCCTGG - Intronic
923215663 1:231845766-231845788 CTGGATGTGGTCGTGGAACAGGG + Intronic
923424864 1:233858814-233858836 CTGGAGGTTGGTGGGGAGTCTGG + Intergenic
924414975 1:243849832-243849854 TCGGGTGTGGGTGTGGAGGCCGG - Intronic
924694351 1:246383056-246383078 ATGGGGGTGGGTCTGGAGCCTGG - Intronic
1063046614 10:2398765-2398787 ATGGATGTGTTTGGGGAGCCAGG + Intergenic
1063282517 10:4645769-4645791 CTGAATGTGGAGGAGGAGCCAGG - Intergenic
1065509548 10:26464578-26464600 TTGTATGTGTGTGTGGAGACAGG + Intronic
1065514047 10:26506960-26506982 ATGCATGTGGGTGTGGTGCTGGG + Intronic
1066673729 10:37866065-37866087 CTGGTTTTGGGTCTGGTGCCTGG - Intergenic
1067532387 10:47083673-47083695 CTGGATGACAGTGTGGAGCTCGG - Intergenic
1068860644 10:61844679-61844701 CAGGAAGTGGGTGTGGATACTGG + Intergenic
1068949040 10:62759182-62759204 CTGTTTGTGGATTTGGAGCCAGG + Intergenic
1068971278 10:62960973-62960995 GTGGAGGTGGGTGTGGAGGCAGG + Intergenic
1069813409 10:71178867-71178889 TTGGATGTGGGTGGGGAGCCAGG + Intergenic
1070278768 10:75033603-75033625 CTGGAGGTGGGGTTGGGGCCTGG + Intergenic
1070364652 10:75724874-75724896 CTGGATTTGGTTCTGGAGACAGG - Intronic
1070741713 10:78907654-78907676 CTGGATGTGCATGGGGTGCCCGG - Intergenic
1070799534 10:79237086-79237108 GGGGATGTGGGGATGGAGCCAGG + Intronic
1072770413 10:98133174-98133196 CTGGTTTTGGGTCTGGTGCCTGG - Intergenic
1072818335 10:98531422-98531444 TTGGATGTGGGGCTGCAGCCAGG - Intronic
1073092397 10:100953162-100953184 CTGGGTGTGGATGTGGTGGCAGG - Intronic
1073179191 10:101573825-101573847 ATGGATCTGGGAGAGGAGCCTGG - Intronic
1073866681 10:107812670-107812692 CTGAATGTGGGTGTGGTGAGGGG + Intergenic
1074223345 10:111459936-111459958 CTGGATTTGGGAGTCCAGCCTGG - Intergenic
1074447739 10:113534261-113534283 CTGAAAGTGGGGGTGGATCCCGG - Intergenic
1075594228 10:123716342-123716364 TTGCAAGTGGGTGTGGAGTCGGG - Intronic
1075626198 10:123966013-123966035 TTGGCTGTGGGTGTGGGGCATGG - Intergenic
1075730932 10:124636463-124636485 CTGCATGTGGGTGGTTAGCCGGG + Intronic
1075832115 10:125420131-125420153 CTGCATGTGGGTGTGGGGACAGG + Intergenic
1075950503 10:126473509-126473531 GTGGATGTGGATGTGAAGGCTGG + Intronic
1076670578 10:132118592-132118614 CTGGCTGTGGGTGTGGAGAGCGG - Intronic
1076785229 10:132746183-132746205 CTGGCTGTGCGTGCGGTGCCTGG + Intronic
1076806816 10:132862891-132862913 GTGGATGTGGCTGAGAAGCCAGG + Intronic
1076844234 10:133061106-133061128 CTGGAGACGAGTGTGGAGCCTGG - Intergenic
1077108761 11:853050-853072 GTGGCTGTGGGTGTGGGGGCAGG + Intronic
1077189451 11:1249733-1249755 GTGGCTGTGGGTGTGGTGGCCGG - Exonic
1077225122 11:1436228-1436250 CTGGATGCGGGTGGGGGGGCGGG + Intronic
1077323121 11:1951224-1951246 GTGCCTGTAGGTGTGGAGCCCGG + Intronic
1077326474 11:1966081-1966103 CTGGCTGTGGGTGTGCGGCCTGG + Intronic
1077591262 11:3492630-3492652 CTGGATGGGGGCATGGAGCTAGG + Intergenic
1077831558 11:5877691-5877713 CTTGGAGTGGCTGTGGAGCCAGG - Intronic
1077902218 11:6498562-6498584 ATGGAGGTGGGTTTGGACCCAGG - Exonic
1078654407 11:13225073-13225095 TAGGATGAGGCTGTGGAGCCAGG + Intergenic
1079098572 11:17526865-17526887 GTGGATCTGGATGTGGGGCCTGG - Intronic
1081484512 11:43517063-43517085 CTGGCCGTGGGAGAGGAGCCAGG + Intergenic
1083136672 11:60684648-60684670 CTGGTTTTGGGTCTGGTGCCTGG + Intergenic
1083727922 11:64637956-64637978 CTGTGTGTGGGTGTGGGGCCTGG - Intronic
1083900659 11:65641785-65641807 CTGGCTGGGGGTGAGGAGCCAGG - Intronic
1083938076 11:65880820-65880842 AGGGAAGTGGCTGTGGAGCCAGG - Intronic
1084185119 11:67467443-67467465 GAGGCTGTGGGGGTGGAGCCAGG + Intronic
1084188941 11:67490245-67490267 ATGGAGGGGGGTGTGGAGCCAGG + Intronic
1084246963 11:67864381-67864403 CTGGATGGGGGCATGGAGCTAGG + Intergenic
1084825726 11:71730150-71730172 CTGGATGGGGGCATGGAGCTAGG - Intergenic
1085506957 11:77066445-77066467 ATGGATGTGAAGGTGGAGCCCGG + Intergenic
1085614239 11:77983052-77983074 CCAGATGTAGGTGTGAAGCCTGG + Intronic
1085946151 11:81276216-81276238 CTAGTTGTGGGTGTTGGGCCTGG - Intergenic
1086218572 11:84413168-84413190 CTGGATGTGAGAATGGATCCAGG - Intronic
1087153222 11:94877321-94877343 CTGGGGGTGGGTGAGGAGACAGG - Intergenic
1088665261 11:112087329-112087351 TTGGATGTGGGAGTGGAGGGGGG + Intronic
1089602593 11:119624585-119624607 CTGAGTCTGGGTGTGCAGCCGGG - Intronic
1090246412 11:125218987-125219009 CTGGACATGGGTGTGATGCCTGG - Intronic
1090329806 11:125922257-125922279 ATGGATGTGGCTGGGGAGCAGGG + Intronic
1090396646 11:126423788-126423810 CAGGAGGTGGGTGGGGAGGCTGG + Exonic
1090479916 11:127059100-127059122 GAAGAGGTGGGTGTGGAGCCAGG + Intergenic
1090583093 11:128181165-128181187 AAGGATGGGGGTGAGGAGCCAGG + Intergenic
1090979341 11:131703905-131703927 ATGGAAGTGGGTCTGGGGCCCGG - Intronic
1091178102 11:133579665-133579687 CTGGCGGTGTGCGTGGAGCCGGG - Intergenic
1091225679 11:133955669-133955691 ATGGAAGTGGGAGCGGAGCCTGG - Intronic
1091351541 11:134901537-134901559 CTGAATGTGTCTGTGTAGCCGGG - Intergenic
1091370802 11:135056428-135056450 CTGGCTGTGGGACTGGATCCAGG - Intergenic
1202809455 11_KI270721v1_random:21260-21282 CTGGCTGTGGGTGTGCGGCCTGG + Intergenic
1091493055 12:949541-949563 CTAGCCGTGGGTGTGGAGCGTGG - Intronic
1091520737 12:1239281-1239303 CAGGAGGTTCGTGTGGAGCCAGG - Intronic
1091756757 12:3058171-3058193 CTGGGTCTGGGAGTGGGGCCTGG + Intergenic
1092361508 12:7840526-7840548 CTGGGTGTGGGTGTGGTGGCGGG - Intronic
1095813917 12:46400716-46400738 CTGAAGGAGGATGTGGAGCCAGG + Intergenic
1096574444 12:52544062-52544084 CTAGATGTGGGGGTGGGGACTGG + Exonic
1097035573 12:56121516-56121538 CTGGACGAGGCTGTAGAGCCTGG - Exonic
1097190983 12:57219594-57219616 CTAGAGGAGGGTGTGGAGGCAGG - Intronic
1097246073 12:57608516-57608538 CTGGGTTTGGGTGTTCAGCCTGG - Exonic
1097250177 12:57628084-57628106 CAGGATGTGGGGGTGGAGAAGGG - Intronic
1097381364 12:58899129-58899151 CTGGGTGTGGGTGGGGACCAAGG + Intronic
1099551056 12:84043733-84043755 CTGGAAATGGGTCTGAAGCCAGG - Intergenic
1099970228 12:89492758-89492780 CTGGATGTGGGAGAGGAAGCAGG - Intronic
1100382320 12:94073417-94073439 TTGGCTGTGGGAGAGGAGCCTGG - Intergenic
1101498075 12:105274828-105274850 CTGGATGCTAGTGCGGAGCCTGG + Intronic
1102524338 12:113500573-113500595 CTGGAGCTGGGTGTGAGGCCTGG + Intergenic
1103074167 12:117968958-117968980 CAAGATGTCGGTGTGGAGCGAGG - Intronic
1103596978 12:122030095-122030117 CTGAATGTGTGGGTGCAGCCAGG - Intronic
1103705632 12:122870303-122870325 CTGGAGGTGCGTGTGGACCTGGG + Intronic
1103851250 12:123934948-123934970 CTGTATGTGTGTGTGGATGCCGG + Exonic
1103926542 12:124426571-124426593 CAGGATGGGGGTGGGGGGCCGGG + Intronic
1104179329 12:126363157-126363179 GTGGGTGTGGCTGTGGATCCAGG - Intergenic
1104271076 12:127282781-127282803 ATGGATGTGGGCTTGGATCCTGG - Intergenic
1104273653 12:127305259-127305281 CTGGATGTGAGGGAGGAGCCAGG + Intergenic
1104275737 12:127325837-127325859 TTGGGTGAGGGTGTGGAGTCTGG - Intergenic
1104346494 12:128004435-128004457 CTGGTTTTGGGTCTGGTGCCTGG - Intergenic
1104789672 12:131473620-131473642 CTATATCTGGGTGAGGAGCCCGG - Intergenic
1104844217 12:131838736-131838758 GTGGAGGTGGGTGTGTGGCCAGG + Exonic
1106004541 13:25756539-25756561 GTAGGTGAGGGTGTGGAGCCTGG + Intronic
1107796063 13:44053035-44053057 CTTGATGTGAGTGGGCAGCCAGG + Intergenic
1108354244 13:49615906-49615928 CTGGTCGTGGCTGTGGGGCCTGG + Intergenic
1108563854 13:51674727-51674749 CTGTATGTGGGTGGGGAGGGTGG + Intronic
1111184862 13:84720432-84720454 CAGGAGGTGGATGGGGAGCCAGG - Intergenic
1111764751 13:92514146-92514168 CTGGGTGTGTGTGTGGGGCGGGG - Intronic
1112046163 13:95600378-95600400 CTGGGAGTGGGTGATGAGCCAGG + Intronic
1112110059 13:96286374-96286396 CTGGATGTGTGTGTGGAGGGAGG + Intronic
1114075598 14:19159591-19159613 CTGGATGTTCGCCTGGAGCCTGG + Intergenic
1114483981 14:23052395-23052417 CTGGGTGTGGGGGTGGAGAAGGG - Intronic
1115201060 14:30854606-30854628 TTGGATGTGGGTGTTGAGGAAGG - Intergenic
1115628709 14:35221572-35221594 CTGGTTGTAGGGCTGGAGCCAGG - Intronic
1115729924 14:36257788-36257810 CTGGATGTGGTGGTGTAGCTGGG - Intergenic
1116047016 14:39755750-39755772 CTGGATGTGGGTGTTGTGGAAGG + Intergenic
1116248787 14:42455368-42455390 CGGCATGTGCGTCTGGAGCCGGG - Intergenic
1116864208 14:50018154-50018176 TTTGATGTGGGAGTGGAGCAGGG + Intergenic
1117007431 14:51436052-51436074 CTTGAGGTGGGAGTGGAGACAGG - Intergenic
1117313449 14:54551152-54551174 CTGGGTGGGGGTGAGGAGGCAGG - Intergenic
1118497047 14:66317023-66317045 CTTGATGGGGTTGTGGAGCCAGG - Intergenic
1122169686 14:99862054-99862076 CTGGAGGAGGCTGAGGAGCCAGG - Intronic
1122552763 14:102558908-102558930 CAGGCAGTGGGTGGGGAGCCAGG - Intergenic
1122774887 14:104112759-104112781 GTGGATGTGTGTGGGGAGTCAGG + Exonic
1122977245 14:105175880-105175902 CTGGAGGAGGCTGTGGAGGCTGG + Intronic
1123119341 14:105909583-105909605 CTGGATGTGGGGTTTGTGCCTGG + Intergenic
1124347782 15:28933980-28934002 CTGGAGGTGGGGGTGGTTCCAGG + Intronic
1125403940 15:39333512-39333534 CTGGATATGTGTGTGCACCCTGG - Intergenic
1125538883 15:40458561-40458583 GGGGTTGAGGGTGTGGAGCCAGG + Exonic
1125762135 15:42103986-42104008 CAGGATGTGCCTGTGGAGACAGG - Intergenic
1126112080 15:45181240-45181262 CTGGAGCTGGGTGTGGAGCCAGG - Intronic
1127361381 15:58247616-58247638 TTGGATGGGGGTCTGCAGCCTGG + Intronic
1127864752 15:63023275-63023297 GTGGATGTGGGCTTGGAGCTTGG - Intergenic
1128772641 15:70293822-70293844 CTGGGGGTGGGTGTGGGGCAGGG + Intergenic
1129249880 15:74302993-74303015 CTGGGTGTGGGTCTGGGGGCAGG - Intronic
1131049028 15:89334440-89334462 CCGGGTGTGGGTGTGGGTCCCGG - Intronic
1131107780 15:89746496-89746518 CTGTGTGTGTGTGTGGAGGCGGG - Intergenic
1132517493 16:372598-372620 CTCCATGTGGGTAAGGAGCCGGG - Exonic
1132637027 16:955740-955762 CTGGCTGTCTGTGTGTAGCCAGG - Intronic
1132709789 16:1261343-1261365 CTGGACGTGGGTGTAGACGCCGG + Intergenic
1133026441 16:2990831-2990853 CTCGGTGTGGCTGTGGAGCAGGG + Intergenic
1133206658 16:4238171-4238193 CTGGATTTGGGTTTGGAGCAGGG + Intronic
1133281348 16:4667164-4667186 CTGGAGGTGGGTGGAGAGCCTGG - Intronic
1133885178 16:9820737-9820759 CTGGAAGAGGGTGTGGGGCGGGG + Intronic
1134201704 16:12204786-12204808 GCACATGTGGGTGTGGAGCCAGG - Intronic
1135354872 16:21760628-21760650 CTAGATGAGGGTCTGGATCCAGG - Exonic
1135453356 16:22576770-22576792 CTAGATGAGGGTCTGGATCCAGG - Intergenic
1136252020 16:29011616-29011638 CTGGACCTGGATGTGGAGCCTGG - Intergenic
1136477566 16:30523029-30523051 CTGGGAGAGGGTGTGGAGCTAGG - Exonic
1136713670 16:32259939-32259961 CTAGATGTGTCTGTGAAGCCAGG - Intergenic
1136754242 16:32669492-32669514 CTAGATGTGTCTGTGAAGCCAGG + Intergenic
1136813871 16:33200873-33200895 CTAGATGTGTCTGTGAAGCCAGG - Intronic
1136820347 16:33310953-33310975 CTAGATGTGTCTGTGAAGCCAGG - Intergenic
1136826910 16:33367492-33367514 CTAGATGTGTCTGTGAAGCCAGG - Intergenic
1136831976 16:33466263-33466285 CTAGATGTGTCTGTGAAGCCAGG - Intergenic
1138519977 16:57565584-57565606 CAGGTTGTGGGTGGGGAGTCGGG - Intronic
1139436808 16:66941233-66941255 ATGGATGTGGGTGTAGAGGAAGG + Intronic
1139527528 16:67526042-67526064 TTGGATGTGGGGGAAGAGCCAGG + Intronic
1139671251 16:68493493-68493515 CTGGATGGTGGGGTGAAGCCTGG + Intergenic
1139923514 16:70473646-70473668 CAGGATGTGGGTGCAGAGCGTGG + Intronic
1140473178 16:75226146-75226168 GTGGATTGGGGTGTGGGGCCCGG - Intergenic
1140652349 16:77102194-77102216 GTGGATGTGGGTGTGGACATGGG - Intergenic
1141525762 16:84610379-84610401 CTGGTGGTGGGAGTGGAGACAGG - Intronic
1141529417 16:84635859-84635881 CGGGATGTGGGTGTGGAACAGGG - Intergenic
1142059642 16:88021079-88021101 CTCGATGGGGGTCTGGAGGCCGG + Intronic
1202992447 16_KI270728v1_random:23847-23869 CTAGATGTGTCTGTGAAGCCAGG - Intergenic
1203056388 16_KI270728v1_random:929823-929845 CTAGATGTGTCTGTGAAGCCAGG + Intergenic
1142480713 17:216559-216581 CTGAGGGTGGGTGTGGAGCGAGG + Intronic
1143680908 17:8475360-8475382 CTTGATGTGGCTGAGGAGTCGGG + Exonic
1143981813 17:10876489-10876511 CTGGATTGGGGTGTGGGGACAGG + Intergenic
1144779213 17:17799495-17799517 CTGGATGAGGCAGTGGAGTCGGG - Intronic
1144998702 17:19288640-19288662 CAGTATGTGGGGGTGGAGCGTGG + Intronic
1146263909 17:31438570-31438592 CGGGATGGGGGTGTGGAGAGAGG - Intronic
1146706407 17:35003737-35003759 CTGGATGGCGGTGGGGAGCGTGG - Intronic
1146796532 17:35785067-35785089 CTGGGAGTGGCTGTGGAGTCTGG + Intronic
1147050008 17:37787186-37787208 CTGCATGTGGGTGTGGGGGCTGG + Intergenic
1147182195 17:38693464-38693486 ATGGATGTGGGAGAGGAGTCAGG + Intergenic
1147794182 17:43030906-43030928 CTGGATGTGGTGTTGGAGCTGGG + Intergenic
1148351880 17:46947101-46947123 CTGGAGGTGGGTGTGGAGGAAGG + Intronic
1149112123 17:53046541-53046563 CTGTGTGTGTGTGTGGAGCAGGG + Intergenic
1150481421 17:65514452-65514474 GGGGGTGTGGGTGGGGAGCCTGG + Intergenic
1151349702 17:73524510-73524532 CTGGATGTGGGTGTCCTGGCAGG - Intronic
1152033932 17:77860153-77860175 CAGGATGGGTGTGTGGATCCTGG - Intergenic
1152545364 17:80997690-80997712 CTGGATGTGAGCCTGGGGCCAGG - Intronic
1152607587 17:81300482-81300504 CTGGGTGTGCTTGTGGCGCCTGG + Intergenic
1152839699 17:82559229-82559251 CTGTATGTGGATGTGGAGTGCGG + Intronic
1155002753 18:21703417-21703439 CTGCAGCTGGGGGTGGAGCCGGG + Intronic
1156797934 18:41070982-41071004 CTGGTAGTGGGTGTGTAGCAGGG - Intergenic
1158435625 18:57434161-57434183 CTGGAGGTGGGAGTGGAACTGGG - Intergenic
1158452661 18:57580851-57580873 CTGGGAGTGGGTGTGGAGCTTGG - Intronic
1160424252 18:78769455-78769477 CTGGATGTGGGTGGGGGGACTGG - Intergenic
1160658618 19:287903-287925 CTGGAGGTCTGTGTGGGGCCGGG - Intronic
1160911053 19:1473993-1474015 CTGGCTGTGGGTCTGGAGAGAGG + Exonic
1161741563 19:6024126-6024148 CAGGATGGGGGTGCAGAGCCTGG - Intronic
1161960549 19:7520680-7520702 CTGGGGGTGGATCTGGAGCCGGG - Exonic
1162022994 19:7876446-7876468 CTGGGTGTGGGTGGGTAGACAGG - Intergenic
1162402048 19:10452494-10452516 CTGGATGTGGGTCTGGATGTGGG + Intronic
1162722224 19:12669301-12669323 CGGGTTGTGGGTGTGGATCGGGG - Intronic
1162907819 19:13833882-13833904 GTGGAGGTGGGTGGAGAGCCCGG + Intergenic
1163038375 19:14584785-14584807 CTGCATGTGGATGTGGGGACAGG - Intronic
1163039070 19:14589046-14589068 CTGCATGTGGATGTGGGGACAGG - Intronic
1163111868 19:15166213-15166235 CTGGGTGTGGGTGTGCAGACAGG - Intronic
1163700769 19:18785485-18785507 CTGGCTGTGGGTGAGAAGCGGGG - Exonic
1165246299 19:34500298-34500320 GTGGGTGTGGGTGTGGAGGGAGG + Exonic
1165355402 19:35300694-35300716 CTTGATGTGGGTCTGGTCCCAGG + Intronic
1166010194 19:39935773-39935795 CTGGGTGTCTGTGTGGAACCAGG - Intergenic
1166047426 19:40237764-40237786 CTGGACCTTGGTGGGGAGCCTGG + Intronic
1166047440 19:40237808-40237830 CTGGACCTTGGTGGGGAGCCTGG + Intronic
1166047454 19:40237852-40237874 CTGGACCTTGGTGGGGAGCCTGG + Intronic
1166122648 19:40694645-40694667 TTGGATGTGCATGTGAAGCCTGG - Intronic
1166236955 19:41463804-41463826 CTGGTTTTGGGTCTGGTGCCTGG + Intergenic
1166416987 19:42602353-42602375 CTTGATGTGGGGGTGGGGCAGGG - Intronic
1167231957 19:48290598-48290620 CTGGGGGTGGGAGTGGACCCAGG - Intergenic
1167505737 19:49870138-49870160 CTAGAAGTGGGCTTGGAGCCCGG - Intronic
1167517706 19:49932831-49932853 CAGGATGTGGGTAGGGGGCCAGG - Exonic
1168220820 19:54959071-54959093 CTGGTTTTGGGTCTGGTGCCTGG + Intronic
1168408084 19:56121079-56121101 CTGGGGGTGGGTGGGGAGACTGG - Intronic
1168432561 19:56293069-56293091 TTGGAGGTGGGTGTGGGGCATGG - Intronic
1202711506 1_KI270714v1_random:21819-21841 CTGGGGGTGTGTGTGGAGACTGG + Intergenic
924990587 2:309533-309555 CTGGAAGTGGGTGGGGCCCCTGG - Intergenic
925006583 2:447742-447764 CTGGTGGTGGGTGAGGTGCCAGG - Intergenic
926136935 2:10343040-10343062 CTGGATGTGTGTGTAGAGTAGGG + Intronic
926217485 2:10914301-10914323 CAGGAGGTAGGTGTGCAGCCGGG + Intergenic
926724212 2:15984680-15984702 CGGGAGGTGGGCCTGGAGCCAGG + Intergenic
927250768 2:20993214-20993236 CTGGAGGCGAGAGTGGAGCCTGG + Intergenic
928894726 2:36247512-36247534 CTTGATTTGGGTTTGGAACCAGG - Intergenic
929542270 2:42831407-42831429 CTGGATGTGGGGGTGGGGTGGGG + Intergenic
929805448 2:45140865-45140887 CTGCACTTGGGTGTGGAGCATGG + Intergenic
930442342 2:51424964-51424986 CTGGCTGTGGGAGTAGAACCTGG - Intergenic
930666023 2:54099430-54099452 CTGGGGGTGGGAGTGGAGACTGG - Intronic
931925238 2:67065268-67065290 CTGGATTTGGTTCAGGAGCCTGG + Intergenic
932280782 2:70489978-70490000 CTGGGTGTGGGGGTGGGCCCTGG - Intronic
932301519 2:70670790-70670812 CTGTAGTTGGGTGGGGAGCCCGG - Intronic
932764316 2:74460457-74460479 CAGGAGGGGGGTGTGGAGGCAGG - Exonic
933665478 2:84961085-84961107 GTGTATGTGTGTGTGGAGCAGGG - Intergenic
933764124 2:85695517-85695539 CAGGAGGTGGGAGTGGAGGCTGG + Intronic
934567196 2:95347329-95347351 CTGGGTGTGAGTGAGGCGCCTGG + Intronic
934754641 2:96816626-96816648 CTGGCGGTGCGCGTGGAGCCGGG + Exonic
935627579 2:105184119-105184141 CTGGAGGAGGCTGTGGAGGCCGG - Intergenic
935715962 2:105939221-105939243 CTGCATGGGGGTGTAGAGCAGGG + Intergenic
936506575 2:113112492-113112514 AGGGATGTGAGTGTGGAGGCCGG + Intronic
936545310 2:113387209-113387231 TTGGAGGTGGGTGTGGAGGGTGG + Intergenic
936568082 2:113595562-113595584 CTGGATGCTGGGGAGGAGCCGGG + Intergenic
938097882 2:128475256-128475278 CTGGAGGTGGGGGCTGAGCCAGG + Intergenic
941547859 2:166876426-166876448 CTGGCTTTGGGTATGGAGACAGG + Intergenic
944207234 2:197169557-197169579 CTGGAGGTGGGAGTGGAGTAGGG - Intronic
944921741 2:204421298-204421320 CTGGAGGTGGAGGTGGAGGCTGG - Intergenic
946978736 2:225183134-225183156 CTGTATGTATGTGTGGTGCCGGG - Intergenic
948612154 2:239176598-239176620 CTCTGTGTGTGTGTGGAGCCTGG - Intronic
948619498 2:239225537-239225559 CTGGATGGAGGGGTGGAGCCTGG + Intronic
948672530 2:239577715-239577737 CTGGATGGGGGTGTGGCCCCTGG - Intergenic
948789907 2:240371830-240371852 TTGGATGGTGGCGTGGAGCCTGG + Intergenic
948884159 2:240874665-240874687 CTGGGTGTGAGTCAGGAGCCTGG + Intronic
949071993 2:242030964-242030986 GGGGGTGTGGGTGTGGGGCCAGG - Intergenic
1168830590 20:843287-843309 CTGGATTGGGGTGGGGAGGCAGG - Intronic
1169197179 20:3689583-3689605 CTGGAGGTGGGTCTGGAGCTGGG - Exonic
1169992898 20:11523201-11523223 CTGGATGTGTGAGTGGGGTCAGG + Intergenic
1170746309 20:19102108-19102130 AGGGATGGGGGTGGGGAGCCAGG + Intergenic
1171415677 20:24979160-24979182 TTGGATGGGGGTGGGGAGCTGGG - Intronic
1171936140 20:31277327-31277349 ATGGAGGTGGGCCTGGAGCCTGG + Intergenic
1172587332 20:36093729-36093751 GTGGATGTGGGTGTGGGTGCGGG + Intronic
1173417097 20:42866367-42866389 CTGGATTTGGGTGTGGAGTCAGG - Intronic
1174678168 20:52377763-52377785 TTGGATCTTGGTGTGGATCCTGG + Intergenic
1175518987 20:59587734-59587756 CTGGAGCTGGGGCTGGAGCCGGG + Intronic
1175757984 20:61541934-61541956 CTGGATATGGCTGTGTGGCCTGG + Intronic
1175928294 20:62481313-62481335 CTGGGTGGGGTTGGGGAGCCTGG + Intergenic
1175960590 20:62634557-62634579 CTGGATGGGGGTGGGGTCCCAGG - Intergenic
1176112437 20:63416731-63416753 CTGGCTGTGGGTCTGGAGTCGGG - Intronic
1176415933 21:6474823-6474845 CTGGCGGTGGGAGGGGAGCCCGG + Intergenic
1176954560 21:15086291-15086313 CTGGATGGGGGTGTGGTGGGGGG - Intergenic
1177162231 21:17560201-17560223 GTGGATGGCGGGGTGGAGCCTGG - Intronic
1178255861 21:31052019-31052041 CTGGATGAGGGTGGGGAGACAGG + Intergenic
1179248347 21:39652192-39652214 CTGGATGTGAGTGGTGAGCCAGG + Intronic
1179335497 21:40448167-40448189 CTGGATGTGTCTGTGAAGCGAGG + Intronic
1179691433 21:43083157-43083179 CTGGCGGTGGGAGGGGAGCCCGG + Intergenic
1179711161 21:43264025-43264047 ATGGATGTGGGCATGGAGACTGG - Intergenic
1180098423 21:45572555-45572577 TGGGGTGTGGGTGTGAAGCCTGG + Intergenic
1180743093 22:18067359-18067381 CAGAAGCTGGGTGTGGAGCCAGG - Intergenic
1181464954 22:23105966-23105988 CTGGGTCTGGGTGTGAAGCCAGG + Intronic
1181566640 22:23742783-23742805 TTGGATGGGGGAATGGAGCCTGG + Exonic
1181953345 22:26570686-26570708 CTGCACCTGGGTGTTGAGCCTGG + Intronic
1182013648 22:27021204-27021226 ATGGATGTGGGTGTGGGGGATGG - Intergenic
1182014667 22:27029771-27029793 CTGGATCTGGGTGTGATGCTGGG + Intergenic
1183358252 22:37370666-37370688 CAGGAGGTGGGTGTGGGGCAGGG + Exonic
1184171026 22:42759900-42759922 GTGGATGAGGGGGTGGAGCAGGG - Intergenic
1184729351 22:46364427-46364449 CTGGAGGTGGGAGTGGGGCTGGG - Intronic
1184735440 22:46395159-46395181 ATGGATGTGTGTGTGCAGCGTGG + Intronic
1184771945 22:46602313-46602335 CAGCATGTGGGTGTGGGGTCAGG - Intronic
1185075010 22:48678307-48678329 CTGCATCCAGGTGTGGAGCCCGG - Intronic
1185085315 22:48737742-48737764 CTGGATGTGACTGTGGCTCCAGG + Intronic
1185116908 22:48943009-48943031 CTGGAAATGGGTCTGGGGCCCGG + Intergenic
1185380122 22:50504218-50504240 CCGGGGGGGGGTGTGGAGCCCGG - Intronic
1185422922 22:50744991-50745013 CTGGAGGTGGGGGTGGGGGCGGG - Exonic
949508765 3:4750611-4750633 CTGGCTGTGGGTGGGCGGCCAGG + Intronic
950153933 3:10708329-10708351 CTGGCTGTGGGGGTGGGGCGGGG - Intergenic
950187440 3:10953796-10953818 CTGGCTGTGGGGGCTGAGCCAGG - Intergenic
950445510 3:13035189-13035211 CTGGATGTGGATTAGGAGCCGGG - Intronic
951842412 3:27048393-27048415 CTGAAGGTGAGTGTGGGGCCAGG + Intergenic
952638203 3:35557441-35557463 ATGGATGCTGGTTTGGAGCCTGG - Intergenic
952817860 3:37461183-37461205 CTGGTTGTTGCTGTGGAACCAGG - Intronic
953680994 3:45037845-45037867 CTGCGTGTGAGTGTGGAACCTGG + Intergenic
953999863 3:47547509-47547531 CTGGATGTGGAGGCGGAGGCAGG - Intergenic
954253654 3:49388190-49388212 GTGGGTGTGTGTGTGGAGACGGG + Intronic
954365813 3:50145439-50145461 TTGGATTTGAGGGTGGAGCCAGG - Intergenic
956825125 3:72990963-72990985 GTGGGTGTGGGTGTGGAGAAAGG + Intronic
957041647 3:75340656-75340678 CTGAATGTGAGTGAGGGGCCAGG - Intergenic
959294825 3:104522108-104522130 CTGGTTTTGGGTCTGGTGCCTGG - Intergenic
960547933 3:118938377-118938399 CAGGAAGTGGGTGGGGATCCTGG - Intronic
961046363 3:123711447-123711469 CTGAATGTGAGTGAGGCGCCAGG - Intronic
961368609 3:126416263-126416285 CTGGACGCGGGTGGGGAGCCTGG + Intronic
961381781 3:126500232-126500254 CTGGAAGTTGGTGGGGAGCATGG - Intronic
961452464 3:127008600-127008622 CTGGCTGTGGGTGTGGAGCCGGG + Intronic
961895080 3:130160115-130160137 CTGGATGGGGGCATGGAGCTAGG + Intergenic
961906001 3:130263952-130263974 CTGGAGGTGGCTGAGCAGCCGGG + Intergenic
961916527 3:130380985-130381007 CTGGATGTGAGGGTGATGCCTGG - Intronic
962089724 3:132230495-132230517 GTGGATGTGGGGGTGGAGGCCGG - Intronic
962090592 3:132240442-132240464 CTGGATTTGGTTCTGGAGCAGGG - Intronic
964383818 3:156126213-156126235 CTGGATCTGGGAGTGTGGCCAGG + Intronic
966927225 3:184652634-184652656 CAGGATGTGTGGGTGGAACCAGG - Intronic
967669576 3:192217088-192217110 CTGGGTGGGGATGTGAAGCCAGG - Intronic
967814415 3:193787153-193787175 CTGGAGGTGGGTGGGGAGGTGGG + Intergenic
967983970 3:195081841-195081863 CTGGTGGTGGGTGCAGAGCCAGG - Intronic
968006510 3:195246839-195246861 CTGGCTGTGGCTGTGGGGGCTGG - Intronic
968460358 4:721681-721703 CTGCGTGTGGGTGTGGAGAGAGG + Intronic
968460404 4:721835-721857 CTGCATGTGGGTGTGGAAAGAGG + Intronic
968460429 4:721937-721959 CTGCATGTGGGTGTGGGGAGAGG + Intronic
968491345 4:892172-892194 CAGGCGGTGGGTGTGGAGCGTGG - Intronic
968646902 4:1745741-1745763 CTGGGTGTGGGTGTGGAGGGAGG + Intergenic
968735309 4:2292058-2292080 CTGGATGTGACTGAGGAGCCTGG - Intronic
968869973 4:3236813-3236835 CTGGAAGTGGGTTAGGAGCTTGG + Intronic
969005178 4:4013172-4013194 CTGGATGGGGGCATGGAGCTAGG + Intergenic
969131011 4:4991108-4991130 TTGGATTTGGGAGTGGAGACTGG + Intergenic
969392505 4:6901033-6901055 CTGGAGGTGTGGGTGGGGCCGGG - Intergenic
969459795 4:7322897-7322919 CTGGATGGGGGTGGGGAGGCAGG - Intronic
971117371 4:23664092-23664114 ATGGATTTGGGGGTTGAGCCGGG + Intergenic
971293969 4:25372853-25372875 CTGGTTTTGGGTCTGGTGCCTGG + Intergenic
972076798 4:35100620-35100642 CTGGTTTTGGGTCTGGTGCCTGG - Intergenic
972077904 4:35108867-35108889 CTGGTTTTGGGTCTGGTGCCTGG - Intergenic
973869181 4:55147552-55147574 CTGGGTGTGTGTGTGGGGTCAGG - Intergenic
976205315 4:82618583-82618605 CTGGATGTGGGTGATGAGGAAGG + Intergenic
976324612 4:83757175-83757197 CTGGTGGTGGGTGGGGTGCCAGG + Intergenic
976969588 4:91089359-91089381 CTGGTTTTGGGTCTGGTGCCTGG + Intronic
977172161 4:93776554-93776576 CTGCATGTTGATATGGAGCCAGG - Intergenic
977638219 4:99325132-99325154 CTGGCTGTGGCTGTGGAGCCTGG + Intergenic
979829494 4:125281876-125281898 CAGGATGTGGGTGGGGCGCGGGG + Intergenic
979830153 4:125289668-125289690 TTGGCTGTAGGTGTGGAGCATGG + Intergenic
980129825 4:128808354-128808376 CTGGATGTGGGTCTGGATGTGGG + Intergenic
980977596 4:139625727-139625749 CTGGAAGTGTGTGTGGTACCAGG - Intergenic
984167478 4:176320034-176320056 CTGGGTGTGCGTGTGGAGTCCGG + Exonic
985672671 5:1214356-1214378 AGCGATGTGGGTGTGGAGCAGGG - Intronic
986143206 5:5050866-5050888 CTGGATGGGGGTGTGGGTGCTGG + Intergenic
986338208 5:6770168-6770190 CTGGATCTGGGAGTGGGGCAAGG + Intergenic
986506669 5:8458249-8458271 CAGGATGTGTGTGTGGCTCCTGG + Intergenic
987060058 5:14233967-14233989 TTGTATGTGTGTGTGGAGACAGG + Intronic
988433075 5:31142331-31142353 CTGGATGTTGGTGTGAATCTTGG - Intergenic
989118225 5:37977491-37977513 CAGGATGTGTGTGTGCAGCCAGG + Intergenic
991409049 5:66328918-66328940 CTGGGTGTGGGTGTGGAGAAAGG + Intergenic
992018454 5:72598980-72599002 CTGGTTTTGGGTCTGGTGCCTGG + Intergenic
992043222 5:72858425-72858447 GTGGAGGTGGGTGTGAAGGCAGG - Intronic
995047779 5:107670550-107670572 CTGGATGTGTGTGTTCAGCCAGG - Exonic
995183914 5:109252520-109252542 CTGGGTGAGGGTGTGCAGCAAGG - Intergenic
995946114 5:117648358-117648380 CTGGAGGTGGGTGGGGAGCAAGG - Intergenic
998250204 5:140547493-140547515 CTGGAAGCTGGTGTGGGGCCTGG + Intronic
999511784 5:152259834-152259856 CTGGCTGTGTGTATTGAGCCAGG + Intergenic
999754608 5:154655062-154655084 CTGGGTCTGGGTGTGGGGGCAGG - Intergenic
1001655475 5:173345506-173345528 CAGCATGAGGGTGTGCAGCCTGG - Intergenic
1001679177 5:173543805-173543827 CTGGAAGGGGGTGTGGTGTCTGG - Intergenic
1001743280 5:174070956-174070978 CTGGATCAGGGTGTGGGGTCAGG - Intronic
1001772279 5:174305409-174305431 GTGGAGCTGGGTGTGCAGCCTGG + Intergenic
1001794899 5:174493696-174493718 GTGGATGTGGGCGTGGGGCCAGG + Intergenic
1001948282 5:175797710-175797732 CTGGAGGTGGGGGCGGAACCCGG - Intronic
1002064296 5:176644372-176644394 CTGGATGTGACTGTATAGCCTGG - Exonic
1002095413 5:176828078-176828100 CTGGGGGTGGGTGTGGAGGAGGG - Intronic
1002103843 5:176870237-176870259 CTGGATTTGGGTGCAAAGCCAGG - Intronic
1002339321 5:178504588-178504610 CTGGAAGTGGGTGTGGGGAAAGG + Intronic
1002407709 5:179048876-179048898 CTGGTTTTGGGTCTGGTGCCTGG + Intergenic
1002917156 6:1538581-1538603 GTGGCTGTGGGTGAGGGGCCTGG - Intergenic
1003013526 6:2449316-2449338 CTGGATGTGAGTGCTGACCCTGG + Intergenic
1003442839 6:6159465-6159487 CTGGACATGGGGCTGGAGCCAGG + Intronic
1004473028 6:15946076-15946098 CTGAATGTGCCTGTGGAGTCTGG + Intergenic
1004866626 6:19859055-19859077 CAGGTTGTGGGAGGGGAGCCTGG + Intergenic
1006337673 6:33428838-33428860 CTGGATGTGGGTGGTGTGGCTGG + Intronic
1006368625 6:33631051-33631073 CTGGTGGTGGGTGGGAAGCCTGG - Intronic
1006415008 6:33898384-33898406 CTGCCAGTGAGTGTGGAGCCAGG - Intergenic
1006524083 6:34589024-34589046 CTGGATGGGGGTGTGGTAACAGG + Exonic
1006804730 6:36780660-36780682 CTGGAGGTGGGAGTGGGGCAGGG - Intronic
1006871812 6:37258155-37258177 CTGGATGTGGGTGTAGACCGGGG + Intronic
1007164985 6:39822869-39822891 CTGGCTGGGGGTGAGGACCCAGG - Intronic
1007269018 6:40621414-40621436 CTGGATTTGGGAGTGGGGACAGG + Intergenic
1007350522 6:41270095-41270117 CTGGCAGTGGGGTTGGAGCCAGG - Intronic
1007400463 6:41599786-41599808 CTGGATGTGGGTGTGGAGCCGGG - Exonic
1007730995 6:43946389-43946411 GTGAATGTGGATGTGGAGCTGGG - Intergenic
1008090636 6:47290396-47290418 GTGGATTTGGGTGTGGAGTTGGG + Intronic
1009932486 6:70193163-70193185 CTGGATGAAGGTGTGGCCCCTGG + Intronic
1011547877 6:88500610-88500632 GGGGATGTGGGTGTGGAGAAAGG + Intergenic
1012997932 6:105992377-105992399 CTGGAAGGGGGTGATGAGCCGGG - Intergenic
1015532305 6:134232706-134232728 CTGGGTGTGGTTGTGGGGGCCGG + Intronic
1018635116 6:165854236-165854258 CTGGACGTCAGGGTGGAGCCCGG + Intronic
1018792915 6:167163176-167163198 CTGGACCTGGGAGGGGAGCCAGG - Intronic
1019623241 7:2002754-2002776 CTGGGTCTGGTTGTGGGGCCAGG + Intronic
1019687643 7:2390601-2390623 CAGGATGTGGGCGTGTAGGCAGG - Intergenic
1020765916 7:12320882-12320904 CTGGCTCTGTGTGTGGAGCAAGG - Intergenic
1020770109 7:12379947-12379969 CTGCGTGTGGGTGTGGTGGCGGG + Intronic
1023034596 7:36119315-36119337 CTGGAGGTGGGTGTGGAAGTTGG + Intergenic
1023291369 7:38671971-38671993 GTGGGTGTGGGTGTGGAGTTGGG - Intergenic
1024062485 7:45709447-45709469 CTTTATGTGGGTGGGGAGTCTGG + Intronic
1024212496 7:47217947-47217969 CTGGTTTTGGGTCTGGGGCCTGG + Intergenic
1026396100 7:69955807-69955829 CTGAATGTGTGTGTCGAGCTAGG - Intronic
1027522033 7:79221292-79221314 CTGGATGTGGTTGTAGAACACGG - Intronic
1029124669 7:98287866-98287888 AGGGGTGTGGGTGGGGAGCCCGG - Intronic
1032306442 7:130736458-130736480 CTGAAAATGTGTGTGGAGCCCGG - Intergenic
1032809400 7:135395678-135395700 CTGGATGTCTGTGGGGAGCTGGG + Exonic
1033244293 7:139705210-139705232 ATGGATCTGGGTGGGGAGGCTGG + Intronic
1033346250 7:140527423-140527445 CGGGATGTAGGTGTGCTGCCAGG + Exonic
1033413966 7:141146186-141146208 TAGGATTTGGGTGTAGAGCCAGG + Intronic
1033834885 7:145298186-145298208 CTGGATGTTGTTTTGGAGCTTGG + Intergenic
1034410099 7:150936323-150936345 CTGGAGGTGTGTGAGGGGCCAGG - Intergenic
1034574549 7:151985804-151985826 CTGGATGTGAGTGAGGTGTCTGG + Intronic
1035601488 8:899521-899543 CTGGCTGTGTGTGTGGTGGCAGG + Intergenic
1036370756 8:8161153-8161175 CTGGATGGGGGCATGGAGCTAGG - Intergenic
1036880137 8:12504477-12504499 CTGGATGGGGGCATGGAGCTAGG + Intergenic
1037210111 8:16375891-16375913 CTGGATGGGGGTTTGCAGGCAGG + Intronic
1037382868 8:18306802-18306824 CTGGATGTGAGGGTGGAAACTGG - Intergenic
1037389547 8:18379666-18379688 CTTGATGTGGGTGTGGAGTGGGG - Intergenic
1037467117 8:19171894-19171916 TTGGTTTTGGGGGTGGAGCCTGG - Intergenic
1037467135 8:19171953-19171975 TTGGTTTTGGGGGTGGAGCCTGG - Intergenic
1037813203 8:22098614-22098636 CTGGAGGTGGGTGCCCAGCCCGG + Exonic
1037860899 8:22404915-22404937 CTGGATGTGGGAGTGGGCCGGGG + Exonic
1038443191 8:27585900-27585922 GTGGAAGAGGGTGTGGGGCCAGG - Intergenic
1039434069 8:37547585-37547607 CTGGAAGTGTGTTTGGGGCCCGG - Intergenic
1040536659 8:48316607-48316629 GAGGATGTGGGTGGGGAGCAGGG + Intergenic
1040891911 8:52326029-52326051 ATGGATGTGGGTCTGAAGTCAGG - Intronic
1041034183 8:53771237-53771259 GTGGATTGGGGTTTGGAGCCAGG - Intronic
1041118136 8:54560431-54560453 ATGGATGCGGATGTGGAGGCAGG + Intergenic
1041348927 8:56929541-56929563 CTGTCTGTGGCTGTGGAGCTGGG + Intergenic
1041714697 8:60922859-60922881 CTGGATGAGGGTGCGGAGCTCGG - Intergenic
1041842049 8:62283345-62283367 CTTGAAGTGGTTGTGGAGACAGG + Intronic
1042784942 8:72536867-72536889 AAGCAGGTGGGTGTGGAGCCAGG + Intergenic
1044534960 8:93347898-93347920 CTGGGTGTGGGTGTGGGTGCAGG + Intergenic
1045393844 8:101740829-101740851 ATGGATGGGGGTGTGCAGCATGG - Intronic
1045724412 8:105155469-105155491 CTGGGTAGGGGAGTGGAGCCAGG - Intronic
1045748979 8:105459307-105459329 CTGGGTGTGTGTGTGGTGGCAGG + Intronic
1046041695 8:108913611-108913633 TTGCATGTGGGTGTGCAGGCAGG + Intergenic
1048382069 8:133874085-133874107 GAGGATGTGGGTGGGCAGCCAGG + Intergenic
1049099832 8:140570785-140570807 CTAGATATGGGTGTGAGGCCTGG - Intronic
1049299508 8:141862178-141862200 CAGGCTGTGTGTGTGGAGCTTGG + Intergenic
1049355620 8:142186756-142186778 CAGGAGGTGGGTAGGGAGCCAGG - Intergenic
1049745826 8:144262868-144262890 CTGCAAGTGGGTGTCCAGCCTGG - Exonic
1049787614 8:144458554-144458576 CTGGTTGGGGGTGTGGGGCTCGG + Intronic
1050240807 9:3632465-3632487 GTGGCTGTGGGTGTGGAGGATGG + Intergenic
1050637389 9:7626668-7626690 CTGGAAGGGGGTGCTGAGCCAGG + Intergenic
1051359453 9:16269147-16269169 CTGGATGTGTGTGTAGAGGTGGG + Intronic
1052486096 9:29101864-29101886 ATGAATGTGGGAGTGCAGCCTGG + Intergenic
1055769489 9:79702184-79702206 CTGGATTGGGGTGTGGAGTGAGG + Intronic
1056938693 9:90937188-90937210 CTGGATGTGGAAGGTGAGCCTGG + Intergenic
1057030157 9:91769243-91769265 GTGGATGTGGATGTGGACACTGG + Intronic
1057608666 9:96520903-96520925 CTGGATGTGGTGGAGGAGGCAGG - Intronic
1057938145 9:99257872-99257894 CTGGAAGTGGGTCTGGAACTGGG + Intergenic
1058806512 9:108597632-108597654 CTGGATTGGGGTTTGGAGCTGGG - Intergenic
1059450993 9:114371458-114371480 CTGGCACTGGGTGTGGAGACAGG - Intronic
1059945503 9:119404881-119404903 CTGGATTGGGGTGGGGATCCTGG - Intergenic
1060560656 9:124540033-124540055 CTGGAAGACAGTGTGGAGCCTGG + Exonic
1060740942 9:126097124-126097146 GAGGATGTGGGTGCAGAGCCTGG + Intergenic
1061176900 9:129003041-129003063 GGGCAGGTGGGTGTGGAGCCTGG + Intronic
1061404555 9:130386163-130386185 CTTGCTGTGGGGATGGAGCCTGG - Intronic
1061551512 9:131337377-131337399 CTGGATGTGTGAGTGGAGTAGGG + Intergenic
1061556969 9:131376623-131376645 CTGGAAGTGGGAGTGGAACCAGG + Intergenic
1061659866 9:132122175-132122197 TTCGAGGTGGGTGAGGAGCCAGG + Intergenic
1061842892 9:133369934-133369956 CAGGGTGTGGGTGTGGGGCGTGG + Intronic
1061996941 9:134190903-134190925 CGGGTTCTGGGTGTGGAGCGTGG + Intergenic
1062034695 9:134377827-134377849 ATGGAGGTGGGTGTGGAGGGGGG - Intronic
1062159277 9:135070739-135070761 GTAGAGGTGGGTGTGGGGCCTGG - Intergenic
1186206421 X:7205229-7205251 CAGGATGTTGGTGTGTAGGCAGG - Intergenic
1186210562 X:7246025-7246047 ACGGATGTGGGGCTGGAGCCTGG + Intronic
1187735163 X:22295662-22295684 CTTTTTGGGGGTGTGGAGCCTGG - Intergenic
1191035724 X:56024806-56024828 CTGGGTTTGGGTCTGGTGCCTGG + Intergenic
1191036700 X:56032089-56032111 CTGGTTTTGGGTCTGGTGCCTGG + Intergenic
1191741250 X:64437522-64437544 CTGAATTTGGGTCTGGTGCCTGG + Intergenic
1192230771 X:69263431-69263453 GTGGATATGGGTGTGGGGTCAGG + Intergenic
1192264192 X:69527717-69527739 CTGGATGTGGGTGGCAAGACAGG + Intronic
1192544749 X:72004344-72004366 GTGGGTGTGCCTGTGGAGCCTGG - Intergenic
1193396995 X:80996793-80996815 CTGGATGAGGATGTGGAGAAAGG + Intergenic
1193915250 X:87355128-87355150 CAGTATGTGCTTGTGGAGCCAGG + Intergenic
1195335536 X:103849649-103849671 CAGGATGTGTGTGTGGGGGCTGG - Intergenic
1195376217 X:104230702-104230724 CTGGATGGGAATGTGGAGCTGGG - Intergenic
1195754469 X:108187493-108187515 CTGGATAGGGGTGAGGAGACAGG + Intronic
1196861859 X:120036176-120036198 CTGGTTTTGGGTCTGGTGCCTGG + Intergenic
1197401285 X:125994386-125994408 ATTGATGTGTGTGTGGAGACAGG + Intergenic
1197885509 X:131213615-131213637 CTGTGTGTGAGTGTGGAGGCGGG - Intergenic
1198094559 X:133366597-133366619 CTGCATCTGTGTGTGTAGCCAGG + Intronic
1198114974 X:133536257-133536279 CTGGATGTGGATGATGCGCCTGG - Exonic
1198969390 X:142265251-142265273 CTGGTTTTGGGTCTGGTGCCTGG - Intergenic
1198970510 X:142273590-142273612 CTGGTTTTGGGTCTGGTGCCTGG - Intergenic
1200182601 X:154159898-154159920 GTGGATGGGGGAGTGCAGCCGGG - Intergenic
1200188255 X:154197012-154197034 GTGGATGGGGGAGTGCAGCCGGG - Intergenic
1200193905 X:154234152-154234174 GTGGATGGGGGAGTGCAGCCGGG - Intergenic
1200199660 X:154271956-154271978 GTGGATGGGGGAGTGCAGCCGGG - Intronic
1200744429 Y:6891199-6891221 CTGGTTTTGGGTCTGGTGCCTGG - Intergenic
1201681141 Y:16644669-16644691 CTGGTTTTGGGTCTGGTGCCTGG + Intergenic