ID: 1007404470

View in Genome Browser
Species Human (GRCh38)
Location 6:41626140-41626162
Sequence TCAGCTTATAAATGGTAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007404470_1007404474 -6 Left 1007404470 6:41626140-41626162 CCAGCTTACCATTTATAAGCTGA No data
Right 1007404474 6:41626157-41626179 AGCTGAGTGTTCTCTAGGGCAGG No data
1007404470_1007404473 -10 Left 1007404470 6:41626140-41626162 CCAGCTTACCATTTATAAGCTGA No data
Right 1007404473 6:41626153-41626175 TATAAGCTGAGTGTTCTCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007404470 Original CRISPR TCAGCTTATAAATGGTAAGC TGG (reversed) Intergenic
No off target data available for this crispr